Start-up of the Anammox process from the conventional activated sludge
in a membrane bioreactor

Tao Wang, Hanmin Zhang

*

, Fenglin Yang, Sitong Liu, Zhimin Fu, Huihui Chen

Key Laboratory of Industrial Ecology and Environmental Engineering, MOE, School of Environmental and Biological Science and Technology, Dalian University of Technology,
Dalian 116024, PR China

a r t i c l e

i n f o

Article history:
Received 7 October 2008
Received in revised form 1 December 2008
Accepted 2 December 2008
Available online 8 January 2009

Keywords:
Anammox
Start-up
MBR
Microbial community succession

a b s t r a c t

A lab-scale membrane bioreactor (MBR) was used to start-up the anaerobic ammonium oxidation (Anam-
mox) process from the conventional activated sludge for 2 months. Results indicated the MBR could be a
novel and suitable system for start-up of the Anammox process. The Anammox activity appeared after 16
days operation, and the average removal efficiencies of ammonia and nitrite were both over 90% in the
end. A final specific Anammox activity of 0.35 g NH

þ
4

—N þ NO


2

—N

(gVSS * d)

1

was obtained. Fluores-

cence in situ hybridization (FISH) analysis confirmed the existence of Anammox bacteria and aerobic
ammonia oxidizing bacteria. On the basis of results on MBR performance and FISH analysis, it was pro-
posed that the start-up process was essentially a microbial community succession under man-made dis-
turbance, and a climax community with Anammox bacteria as the dominant population was finally
established.

Ó 2008 Elsevier Ltd. All rights reserved.

1. Introduction

The Anammox process has been put forward as a new and

promising way to treat wastewater containing a high ammonium
concentration and low COD content in the last years. It is the
microbial oxidation of ammonium with nitrite to dinitrogen gas
under strict anoxic conditions (

Van de Graaf et al., 1995, 1996

).

The stoichiometry of the Anammox reaction was as follows (

Strous

et al., 1998

):

NH

þ
4

þ 1:32NO


2

þ 0:066HCO


3

þ 0:13H

þ

! 1:02N

2

þ 0:26NO


3

þ 0:066CH

2

O

0:5

N

0:15

þ 2:03H

2

O

ð1Þ

In the process, a completely autotrophic nitrogen removal is
achieved. External organic carbon source and aeration, which are
the main operational costs in the traditional system of nitrogen re-
moval, could be excluded, so that the Anammox process would al-
low the reduction of costs compared to the traditional system. The
low amount of surplus sludge would also lead to a reduction in the
operational costs (

Jetten et al., 1997

). As a result, the Anammox pro-

cess can save up to 90% of operation cost as compared to traditional
nitrogen treatment processes (

Jetten et al., 2001

).

Start-up of the Anammox process has been becoming one choke

point on the application of the Anammox process. The responsible
bacteria for Anammox reaction are strictly anaerobic and chemo-
lithoautotrophic, which are identified as a deep member of Plancto-

mycetes (

Strous et al., 1999a,b). Anammox bacteria are widely

discovered, no matter in wastewater treatment systems or in nat-
ure (Van de Graaf et al., 1996; Marcel et al., 2003; Tage et al., 2005

).

However, Anammox bacteria grow so slowly with doubling time of
weeks in many ecosystems (

Strous et al., 1998, 1999a,b

) that the

application of Anammox needs a long start-up time. For example,
the start-up period of a full-size plant built in Rotterdam was
approximately 2 years (

Kuenen, 2008

).

Hitherto, limited studies have been conducted on start-up of the

Anammox process from the conventional activated sludge. To
start-up the Anammox process, the choice of reactor type is very
important. It should be suited for long-term enrichment, cultiva-
tion and quantitative analysis (

Strous et al., 1998

). Various reac-

tors, including fluidized bed reactor (

Van de Graaf et al., 1996

),

sequencing batch reactor (SBR) (

Strous et al., 1998

), rotating bio-

logical contactor (

Egli et al., 2001

) and gas-lift reactor (

Sliekers

et al., 2003

), were applied and optimized to start-up the Anammox

process. SBR was proved to be well accepted for the following
strong points: (1) efficient biomass retention, (2) a homogeneous
distribution of substrates, products and biomass aggregates over
the reactor, (3) reliable operation for more than 1 year, and (4) sta-
ble conditions under substrate-limiting conditions (

Strous et al.,

1998; Jetten et al., 1999; Van Dongen et al., 2001

). Most SBR reac-

tors, using activated sludge as an inoculum, successfully start-up
Anammox with around 4 months or more (

Toh et al., 2002; Dape-

na-Mora et al., 2004; Third et al., 2005; Nutchanat and Suwanchai,
2007

). For a more quickly start-up, the Anammox reactor should be

further improved.

0960-8524/$ - see front matter Ó 2008 Elsevier Ltd. All rights reserved.
doi:10.1016/j.biortech.2008.12.011

*

Corresponding author. Tel.: [phone]; fax: [phone].
E-mail address:

[e-mail]

(H. Zhang).

Bioresource Technology 100 (2009) 2501–2506

Contents lists available at

ScienceDirect

Bioresource Technology

j o u r n a l h o m e p a g e : w w w . e l s e v i e r . c o m / l o c a t e / b i o r t e c h

Fortunately, a membrane bioreactor (MBR) could be developed

as a brand-new alternative to start-up Anammox process. MBR is a
biological wastewater treatment process that uses membrane to
replace the gravitational settling of the conventional activated
sludge process for the solid–liquid separation of sludge suspension
(

Ng et al., 2006

). MBR can overcome some limits of SBR or other

biofilm reactors for start-up of the Anammox process. In the
MBR, biomass retention is not based on settling of biomass. The
effluent is withdrawn via a membrane which is impermeable for
microbial cells. Hence, MBR enables cultivation of slow-growing
bacteria with full biomass retention. It can also make the Anam-
mox bacteria suspend as free cells in the reactor with a stirrer, so
a more homogeneous distribution of substrates and biomass can
be achieved, and a high growth rate of Anammox bacteria was ob-
tained (

Van der Star et al., 2008

). Up to date, only few studies have

been conducted to investigate the performance of MBR on start-up
of the Anammox process.

The purpose of this study was to investigate the performance of

MBR on starting up Anammox from the conventional activated
sludge. FISH analysis was performed to confirm the existence of
Anammox bacteria and a preliminary study on the microbial com-
munity succession during the start-up period was carried out. This
paper presents evidence that MBR is a new and suitable strategy
for start-up of the Anammox process.

2. Methods

2.1. Membrane bioreactor

Fig. 1

depicts the membrane bioreactor (MBR) used during the

experiments, containing a submerged ultrafiltration hollow fibre
membrane module of curtain shape. The system had a total work-
ing volume of 4.8 L. The cylindrical reactor was equipped with a
thermostatic jacket to maintain a fixed temperature of 35 °C. The
sludge, substrates and biomass were fully mixed by a mechanical
stirrer. The reactor and feed vessels were all sealed tightly in order
to maintain anaerobic condition and covered to protect Anammox
bacteria from light and algal growth. The hollow fibre membrane
with a pore size of 0.1

l

m was arranged in the centre of the reactor

to ensure the complete retention of the suspended bacteria in the
activated sludge into reactor. The membrane was made of polypro-
pylene with total area of 0.2 m

2

.

2.2. Origin of biomass

The aerobic activated sludge from Lingshuihe Wastewater

Treatment Plant (Dalian, China) and nitrifying activated sludge
from lab-scale A/O system where simultaneous nitrification and
denitrification (SND) occurred were mixed. The mixed activated
sludge was inoculated in the MBR. Some characteristics were as
follows: MLSS 2.23 g/L, MLVSS 1.52 g/L, and MLVSS/MLSS 68.16%.

2.3. Synthetic wastewater

Ammonium and nitrite were added to a mineral medium in the

required amounts in the form of (NH

4

)

2

SO

4

and NaNO

2

. The com-

position of the mineral medium was as specially described by

Van de Graaf et al. (1996)

. It contains (g/L): KHCO

3

1.25, KH

2

PO

4

0.025, CaCl

2

 2H

2

O 0.3, MgSO

4

 7H

2

O 0.2, FeSO

4

0.00625, EDTA

0.00625, and 1.25 mL/L of trace elements solution. The trace ele-
ment solution was (g/L) (

Strous et al., 1999a,b

): EDTA 15,

ZnSO

4

 7H

2

O 0.43, CoCl

2

 6H

2

O 0.24, MnCl

2

 4H

2

O 0.99, Cu-

SO

4

 5H

2

O 0.25, NaMoO

4

 2H

2

O 0.22, NiCl

2

 2H

2

O 0.19, Na-

SeO

4

 10H

2

O 0.21, H

3

BO

4

0.014, and NaWO

4

 2H

2

O 0.050. The pH

of the synthetic wastewater was adjusted to 8.0 ± 0.1 by 1 M HCl
and 1 M Na

2

CO

3

before providing to the reactor. Considering that

N

2

has the lower price and has the similar function of Ar/CO

2

in

the experiment, the synthetic wastewater was flushed with N

2

in-

stead of Ar/CO

2

to expel the dissolved oxygen for maintaining

anaerobic condition.

2.4. Strategy of operation

The MBR was continuously fed with the synthetic wastewater

by the peristaltic pump and the same way permeate was sucked
up via the hollow fibre membrane module, after the reactor had
been seeded with the mixed activated sludge. In view of the prac-
tical applications of MBR for wastewater treatment, constant flux is
preferable to constant TMP (transmembrane pressure). Therefore,
the MBR in the study was operated in the mode of constant flux.
During the experiment the stirrer worked at speed of 100 rpm to
keep the biomass suspended as free cells. The synthetic wastewa-
ter was replaced every day to avoid the changes in feed composi-
tion due to biological activity or other influencing factors.

The MBR was operated at the following conditions: hydraulic

retention time (HRT) of 2 days, temperature of 35 °C, pH was con-
trolled at around 8.0. The medium concentrations of (NH

4

)

2

SO

4

and

NaNO

2

were both initially set to around 50 mg N/L. The N-loading

rate was increased by shortening the HRT or increasing the concen-
trations of (NH

4

)

2

SO

4

and NaNO

2

in the feed vessel.

2.5. Sampling and analysis

Samplings were performed daily for monitoring the effluent

quality. According to the standard methods for the examination
of water and wastewater (

APHA, 1998

), COD was analyzed, ammo-

nia and nitrite were both measured by using colorimetric method,
while nitrate was analyzed by using ultraviolet spectrophotomet-
ric method. MLSS and MLVSS were measured to demonstrate the
sludge characteristics. The pH was determined with a digital porta-
ble pH meter. The DO level was measured with a digital portable
DO meter (YSI, Model 55, USA).

2.6. FISH analysis

The sludge samples were analyzed by FISH in this study. Cell

fixation and FISH analysis were performed according to the stan-
dard hybridization protocol (

Amann, 1995; Third et al., 2001

).

The probe names, the rDNA target positions and the target organ-

1

2

8

7

6

10

9

4

3

5

Fig. 1. Scheme of the membrane bioreactor: (1) feed vessel, (2) influent pump, (3)
membrane module, (4) mechanical stirrer, (5) recycle pump, (6) heater, (7)
temperature sensor, (8) heating tank, (9) sampling port, and (10) membrane
permeate pump.

2502

T. Wang et al. / Bioresource Technology 100 (2009) 2501–2506

isms are shown in

Table 1

. Probes were purchased as fluorophores

Cy3, Cy5 and FITC labeled from TaKaRa Company (Dalian, China).
Hybridizations were performed on 4% (w/v) paraformaldehyde-
fixed sludge samples. For image acquisitions, an epifluorescence
microscope (OlympusBX51, Japan) was used together with the
standard software package delivered with the instrument (version
4.0). A Leica TCS-SP2 confocal scanning laser microscope (CSLM)
(Leica, Germany) was used to observe more precise situations.

3. Results and discussion

3.1. MBR performance

The MBR was operated for 2 months. The temperature, pH and

DO concentration in the reactor was controlled at 35 °C, 7.8–8.2,
<0.05 mg L

1

, respectively, in order to satisfy the strict require-

ment of Anammox growth and metabolism. The type of biomass
inside the reactor was a suspension of free cells during the whole
experiment. As

Fig. 2

describes, the experimental period could be

divided into three stages: Stage A, day 1–day 16; Stage B, day
16–day 50; and Stage C, day 50–day 60.

In Stage A, denitrifying activity was the favored process in ab-

sence of oxygen and in presence of nitrite, but no Anammox activ-
ity appeared. The effluent ammonia concentration was evidently
higher than the influent ammonia concentration, when almost all
nitrite removal was achieved. The phenomenon was also reported
in previous literatures (

Toh et al., 2002; Dapena-Mora et al., 2004;

Third et al., 2005; Nutchanat and Suwanchai, 2007

). After the

mixed activated sludge was inoculated in the MBR, the sludge
may break down due to the change in environment. The cell lysis
from aerobic bacteria, which can not adapt to the given conditions,
caused breakdown of the organic nitrogen to ammonia (

Nutchanat

and Suwanchai, 2007

). As a result, ammonium concentrations in-

creased greatly, and even the max effluent ammonia concentration
reached 96 mg/L on day 4 which was much higher than the influ-
ent ammonia concentration at about 50 mg/L. The view was sup-
ported by the loss of MLVSS in the reactor without sludge
discharge. At that time, the dead bacteria also released large
amount of chemical oxygen demand (COD), leading that COD in
the reactor ranged from 87 to 191 mg/L during the first week.
The COD could be used as carbon source and electron donor by
denitrifying bacteria, and the nitrite in influent could be used as
electron acceptor. Since anaerobic heterotrophic denitrifying bac-
teria grew much faster than autotrophic Anammox bacteria, deni-
trifying bacteria might predominate in the first stage.

According to Jetten’s research (

Jetten et al., 1999

), COD has

inhibiting effect on Anammox bacteria. Hence, the MBR was settled
for 2 h and the supernatant was discharged carefully on day 4, to
avoid the inhibition of COD to start-up of the Anammox process.
From the day on, the COD content in the MBR decreased, and inter-
estingly, the effluent ammonia concentration also decreased grad-
ually so that the concentration of ammonia in effluent was close to
that in influent at the end of the stage. The phenomenon might be
explained by two aspects: (1) the large amount of ammonia accu-
mulated in the reactor, resulting from cell lysis of the dead bacte-
ria, was discharged from the supernatant after the MBR was settled
and (2) with the COD decreasing, the activity of Anammox bacteria
which might exist in the sludge could be recovered so that part of
ammonia in the reactor could be consumed by Anammox bacteria.

During Stage B, the Anammox activity appeared in the MBR, as

both ammonia and nitrite was removed simultaneously. It was also
observed that the nitrite in effluent increased evidently, showing
the decreasing activity of denitrifying bacteria. The reason was
probably that most organic substrate from the breakdown of the
inoculated sludge exhausted in Stage A. The postulation was sup-
ported by decline of COD in the reactor. Even though the medium
in the MBR was lack of organic substrate, part of denitrifying bac-

Table 1
FISH oligonucleotides probes used in this study.

Probe

Sequence

rRNA
target
position

Target
organism

Reference

NSO190

CGATCCCCTGCTTTTCTCC

16S,
190–
208

Aerobic
ammonium
oxidizing
bacteria

Biesterfeld
et al.
(2001)

AMX820

AAAACCCCTCTACTTAGTGCCC

16S,
820–
841

Anammox
bacteria

Schmid
et al.
(2005)

0

5

10

15

20

25

30

35

40

45

50

55

60

0

10

20

30

40

50

60

70

80

90

100

Stage C

Stage B

Stage A

Nitrogen Concentration (mg/L)

days

NH

4

+

-N(influent)

NH

4

+

-N(effluent)

NO

2

-

-N(influent)

NO

2

-

-N(effluent)

NO

3

-

-N(influent)

NO

3

-

-N(effluent)

Fig. 2. Profile of nitrogen removal during 60 days of operation in the MBR.

T. Wang et al. / Bioresource Technology 100 (2009) 2501–2506

2503

teria could be still survived, but denitrifying bacteria might be not
the dominant population anymore. However, Anammox bacteria in
favoring of the provided substrate and the given conditions in-
creased as the Anammox activity was observed. Thus, in the stage,
it was hypothesized that all ammonia was removed by Anammox
bacteria while the nitrite was removed through the combined
function of both denitrifying bacteria and Anammox bacteria. After
the ammonia influent concentration and the nitrite influent con-
centration were increased from 50 to 75 mg/L and 85 mg/L, respec-
tively, on day 37, the effluent ammonia concentration fluctuated
with the effluent nitrite concentration, and ammonia consumption
rate and nitrite consumption rate seemed to exhibit a good corre-
lation. The interesting phenomenon may demonstrate that Anam-
mox bacteria predominated at the end of the stage.

In Stage C, the Anammox process exhibited a good stability. The

average removal efficiencies of ammonia and nitrite were both
over

90%.

The

specific

Anammox

Activity

of

0.35 mg

NH

þ
4

—N þ NO


2

—N

(mgVSS  d)

1

was obtained. The average ratio

of nitrite consumption to ammonia consumption was 1.15:1, a lit-
tle lower than the previous reported values of 1.32:1 (

Strous et al.,

1998

) and 1.37:1 (

Helmer et al., 2001

). The excess utilization of

ammonia was probably due to the activities of other bacteria, such
as aerobic ammonia oxidizing bacteria living on the leakage of oxy-
gen into the MBR. In

Fig. 2

, nitrate production was observed but the

ratio of nitrate production to ammonia removal was less than the
one obtained by Strous et al. for the stoichiometry of the Anammox
process (

Strous et al., 1998

). The function of nitrate production was

assured to be the generation of reducing equivalents necessary for
the reduction of CO

2

on the growth of Anammox bacteria (

Van de

Graaf et al., 1997

). Therefore, nitrate was produced as Anammox

grew and propagated. However, a small part of denitrifying bacte-
ria surviving in the reactor might reduce nitrate produced by
Anammox bacteria.

In a word, the Anammox process was successfully started up

from the conventional activated sludge in a membrane bioreactor
within 2 months. The start-up period was considered to be shorter
than that in other literatures of usually 4 months or more (

Toh

et al., 2002; Dapena-Mora et al., 2004; Third et al., 2005; Nutchanat
and Suwanchai, 2007

), which may have relation with the complete

retention of biomass in MBR and the phenomenon of simultaneous
nitrification and denitrification (SND) in the inoculation. Some
Anammox bacteria might have already been accumulated in the
nitrifying sludge where SND occurred. The conclusion was subject
to further confirmation.

3.2. FISH analysis

Sludge samples on day 10 and day 60 were analyzed by FISH

technique. Two microbial groups, Anammox bacteria and aerobic
ammonia oxidizing bacteria, were investigated in the study.
AMX820 probe was used to target Anammox bacteria, and
NSO190 probe was used to target aerobic ammonia oxidizing
bacteria.

After 10 days operation, there are only a few bacteria hybridized

with AMX820 and NSO190, presumably Anammox bacteria
(

Fig. 3

A) and aerobic ammonia oxidizing bacteria (

Fig. 3

C), respec-

tively. Since Anammox bacteria grew slowly with the doubling
time of weeks, a few Anammox bacteria detected on day 10 were

Fig. 3. FISH analysis of sludge samples from the MBR on day 10 and day 60: (A, B) blue color indicates Anammox bacteria hybridized with AMX820 probe and (C, D) red color
indicates aerobic ammonia oxidizing bacteria hybridized with NSO190 probe. (For interpretation of the references to color in this figure legend, the reader is referred to the
web version of this article.)

2504

T. Wang et al. / Bioresource Technology 100 (2009) 2501–2506

considered to be originated from the inoculation of mixed conven-
tional activated sludge, which is consistent to the past reports on
discovery of Anammox bacteria in nature ecosystems or wastewa-
ter treatment systems (

Van de Graaf et al., 1996; Marcel et al.,

2003; Tage et al., 2005

). On day 60, the situation in the man-made

ecosystem was quite different. As

Fig. 3

B and D describes, Anam-

mox bacteria became the dominant population and trended to
grow in clusters, while a few aerobic ammonia oxidizing bacteria
still existed in the system. The presence of aerobic ammonia oxi-
dizing bacteria played a positive role in system performance, be-
cause they can consume any oxygen that might leak into the
reactor. This way the reactor can still maintain anaerobic, which
is favorable to Anammox bacteria (

Dapena-Mora et al., 2004

).

3.3. The microbial community succession

From a new point of view, start-up of the Anammox process

from the conventional activated sludge is a process of microbial
community succession essentially. Firstly, the given conditions
were provided to generate an environmental pressure, which could
select the microbial populations that adapted to the conditions.
Just several days after the mixed activated sludge was inoculated
in the MBR, the reactor environment changed greatly resulting
from death of large amount of heterotrophs, when the COD in
the reactor increased quickly. Consequently, denitrifying bacteria,
as pioneer species, occupied the man-made ecological system,
and grew and propagated to become the dominant population at
early stage. The postulation was supported by a high denitrifying
activity and no Anammox activity in Stage A, as discussed above.
As COD was consumed by denitrifying bacteria and continuously
removed from the effluent in the reactor afterwards, denitrifying
bacteria gradually decreased due to limits of organic carbon
source. Anammox bacteria, as species of more competitive power,
replaced denitrifying bacteria as the dominant population. A cli-
max community predominated by Anammox bacteria was
achieved after 2 months operation of the MBR. At that time, the
Anammox process was successfully started up from the conven-
tional activated sludge.

3.4. Membrane fouling

The effect of biomass development on the membrane behavior

was observed as the study progressed. Fouling behavior has impor-
tant engineering implications. As the experiment progressed, the
possibility and potential for fouling became apparent. The evolu-
tion of the transmembrane pressure was monitored to study the

membrane permeability reflecting membrane fouling (

Fig. 4

). The

membrane module was chemically cleaned only once on day 43
to control the membrane fouling as soon as the membrane pres-
sure had reached 0.045 MPa. The membrane module was taken
out of the MBR and washed by pure water, then washed liquid
was collected and concentrated, whose biomass was returned to
the reactor as much as possible. After the membrane was sub-
merged in the solution containing 0.3% NaClO for 24 h, the perme-
ability of the membrane module recovered to more than 90% of the
initial permeability. Due to death of the heterotrophs from the acti-
vated sludge and great changes of the environment in the reactor,
as discussed above, the membrane pressure increased rapidly in
early stage of about two weeks. Subsequently, the membrane pres-
sure increased relatively slowly from day 16 to the end. Thus, cell
lysis from aerobic heterotrophs was proposed to be one key factor
influencing the membrane fouling. After Anammox bacteria domi-
nated the microbial community in the reactor, metabolic products
of the growth of Anammox bacteria were considered to be another
key factor influencing the membrane fouling. As

Fig. 4

shows that

the slope of the first 16 days was remarkably higher than that of
the later period, death of the aerobic heterotrophs probably made
more function on the membrane fouling than growth of Anammox
bacteria did.

4. Conclusions

MBR is a more promising and suitable alternative to start-up

the Anammox process. In the study, the Anammox process was
successfully started up from the conventional activated sludge
using a membrane bioreactor (MBR) within 2 months. Finally the
average removal efficiencies of ammonia and nitrite was both over
90%, and the specific Anammox Activity of 0.35 g

NH

þ
4

—Nþ

NO


2

—NÞ (gVSS * d)

1

was obtained. The start-up period was much

shorter than that reported by others, which was due to the com-
plete retention of biomass in MBR and the inherent properties of
the activated sludge. Combining results on MBR performance with
FISH analysis, it was proposed that the start-up process was essen-
tially a microbial community succession under man-made distur-
bance. After 2 months of operation, a climax community formed,
and it consisted of Anammox bacteria and some other bacteria.
Anammox bacteria became the dominant population in the com-
munity. On the other hand, the membrane fouling was investi-
gated. The transmembrane pressure increased quickly within the
first two weeks but slowly in the later period. The phenomenon
might have relation with death of the aerobic heterotrophs and
growth of Anammox bacteria. The mechanism and the control
strategy of the membrane fouling on the start-up process need fur-
ther research.

Acknowledgement

The authors thank the support given by the National Natural

Science Foundation of China (Project No. 50578024).

References

Amann, R.I., 1995. In Situ Identification of Micro-organisms by Whole Cell

Hybridization with rRNA-Targeted Nucleic Acid Probes. Molecular Microbial
Ecology Manual. Kluwer Academic Publishers, The Netherlands. pp. 1–15.

APHA, 1998. Standard Methods for the Examination of Water and Wastewater, 20th

ed. United Book Press, USA.

Biesterfeld, S., Figueroa, L., Hernandez, M., Russell, P., 2001. Quantification of

nitrifying bacterial populations in a full-scale nitrifying trickling filter using
fluorescent in situ hybridization. Water Environ. Res. 73, 329–338.

Dapena-Mora, A., Van Hulle, S.W.H., Luis, Campos J., Mendez, R., Vanrolleghem, P.A.,

Jetten, M., 2004. Enrichment of Anammox biomass from municipal activated
sludge: experimental and modelling results. J. Chem. Technol. Biotechnol. 79,
1421–1428.

0

10

20

30

40

50

60

0.010

0.015

0.020

0.025

0.030

0.035

0.040

0.045

Transmembrane pressure (MPa)

days

Fig. 4. Profile of transmembrane pressure during 60 days of operation in the MBR.

T. Wang et al. / Bioresource Technology 100 (2009) 2501–2506

2505

Egli, K., Fanger, U., Alvarez, P.J.J., Siegrist, H., Van der Meer, J.R., Zehnder, A.J.B., 2001.

Enrichment and characterization of an Anammox bacterium from a rotating
biological contactor treating ammonium-rich leachate. Arch. Microbiol. 175,
198–207.

Helmer, C., Tromm, C., Hippen, A., Rosenwinkel, K.-H., Seyfried, C.F., Kunst, S., 2001.

Single stage biological nitrogen removal by nitration and anaerobic ammonium
oxidation in biofilm systems. Water Sci. Technol. 43, 311–320.

Jetten, M.S.M., Horn, S.J., van Loosdrecht, M.C.M., 1997. Towards a more sustainable

wastewater treatment system. Water Sci. Technol. 35, 171–179.

Jetten, M.S.M., Strous, M., Pas-Schoonen, K.T., Schalk, J., Dongen, G.J.M., Graaf, A.A.,

Logemann, S., Muyzer, G., Loosdrecht, M.C.M., Kuenen, J.G., 1999. The anaerobic
oxidation of ammonium. FEMS Microbiol. Rev. 22, 421–437.

Jetten, M.S.M., Wagner, M., Fuerst, J., Loosdrecht, M.V., Kuenen, J.G., Strous, M., 2001.

Microbiology

and

application

of

the

anaerobic

ammonium

oxidation

(Anammox) process. Curr. Opin. Biotechnol. 12, 283–288.

Kuenen, J.G., 2008. Anammox bacteria: from discovery to application. Nat. Rev.

Microbiol. 6 (4), 320–326.

Marcel, M.M.K., Kuypers, A., Olav, S., Gaute, L., Markus, S., Bo Barker, J.J., Gijs, K., Jaap,

S.S.D., Strous, M., Jetten, M.S.M., 2003. Anaerobic ammonium oxidation by
Anammox bacteria in the Black Sea. Nature 422 (10), 608–610.

Ng, H.Y., Tan, T.W., Ong, S.L., 2006. Membrane fouling of submerged membrane

bioreactors: impact of mean cell residence time and the contributing factors.
Environ. Sci. Technol. 40, 2706–2713.

Nutchanat, C., Suwanchai, N., 2007. Anammox enrichment from different

conventional sludges. Chemosphere 66, 2225–2232.

Schmid, M.C., Maas, B., Dapena, A., van de Pas-Schoonen, K., van de Vossenberg, J.,

Kartal, B., van Niftrik, L., Schmidt, I., Cirpus, I., Kuenen, J.G., Wagner, M.,
Sinninghe Damste, J.S., Kuypers, M., Revsbech, N.P., Mendez, R., Jetten, M.S.,
Strous, M., 2005. Biomarkers for in situ detection of anaerobic ammonium-
oxidizing (Anammox) bacteria. Appl. Environ. Microbiol. 71, 1677–1684.

Sliekers, A.O., Third, K.A., Abma, W., Kuenen, J.G., Jetten, M.S.M., 2003. CANON and

Anammox in a gas-lift reactor. FEMS Microbiol. Lett. 218, 339–344.

Strous, M., Heijnen, J.J., Kuenen, J.G., Jetten, M.S.M., 1998. The sequencing batch

reactor as a powerful tool for the study of slowly growing anaerobic

ammonium-oxidizing microorganisms. Appl. Microbiol. Biotechnol. 50, 589–
596.

Strous, M., Kuenen, J.G., Jetten, M.S.M., 1999. Key physiology of anaerobic

ammonium oxidation. Appl. Microbiol. Biotechnol. 65, 3248–3250.

Strous, M., Fuerst, J.A., Kramer, E.H.M., Logemann, S., Muyzer, G., Van de Pas-

Schoonen, K.T., Webb, R., Kuenen, J.G., Jetten, M.S.M., 1999. Missing lithotroph
identified as new planctomycete. Nature 400, 446–449.

Tage, D., Bo, T., Donald, E.C., 2005. Anaerobic ammonium oxidation (Anammox) in

the marine environment. Res. Microbiol. 156, 457–464.

Third, K.A., Sliekers, O.A., Kuenen, G.J., Jetten, M.S.M., 2001. The CANON system

(completely autotrophic nitrogen-removal over nitrite) under ammonium
limitation: interaction and competition between three groups of bacteria.
Syst. Appl. Microbiol. 24, 588–596.

Third, K.A., Paxman, J., Schmid, M., Strous, M., Jetten, M.S.M., Cord-Ruwisch, R.,

2005. Enrichment of Anammox from activated sludge and its application in the
CANON process. Microbiol. Ecol. 49, 236–244.

Toh, S.K., Webb, R.I., Ashbolt, N.J., 2002. Enrichment of autotrophic anaerobic

ammonium-oxidizing consortia from various wastewaters. Microbiol. Ecol. 43,
154–167.

Van de Graaf, A.A., Mulder, A., Bruijn, P.D., et al., 1995. Anaerobic oxidation of

ammonium is a biologically mediated process. Appl. Environ. Microbiol. 61 (4),
1246–1251.

Van de Graaf, A.A., de Bruijn, P., Robertson, L.A., Jetten, M.S.M., Kuenen, J.G., 1996.

Autotrophic growth of anaerobic ammonium-oxidizing microorganisms in a
fluidized bed reactor. Microbiology 142 (8), 2187–2196.

Van de Graaf, A.A., De Bruijn, P., Robertson, L.A., et al., 1997. Metabolic pathway of

anaerobic ammonium oxidation on the basis of 15N studies in a fluidized bed
reactor. Microbiology 143 (7), 2415–2421.

Van der Star, W.R.L., Miclea, A.I., Van Dongen, U.G.J.M., Muyzer, G., Picioreanu, C.,

Van Loosdrecht, M.C.M., 2008. The membrane bioreactor: a novel tool to grow
Anammox bacteria as free cells. Biotechnol. Bioeng. 101 (2), 286–294.

Van Dongen, U., Jetten, M.S.M., Van Loosdrecht, M.C.M., 2001. The SHARON-

Anammox process for treatment of ammonium rich wastewater. Water Sci.
Technol. 44, 153–160.

2506

T. Wang et al. / Bioresource Technology 100 (2009) 2501–2506