3513659554

100

direct action on osteoblasts by stimulating their proliferation and differentiation (Gordeladze et al., 2002; Holloway et al., 2002; Martineau et al., 2014).

CD36 is expressed by osteoblasts (Brodeur et al., 2008), but its contribution to bonę metabolism is still poorly documented. In accordance with the Iow bonę mass of Cd36-nuli mice, we measured reduced plasma levels of bonę formation markers, and histology analysis highlighted lower osteoblast perimeter and reduced bonę formation ratę (Kevorkova et al., 2013), suggesting that osteoblastic functions were impaired in the absence of CD36. Although the consequence of CD36 deletion for bonę status is documented, the exact mechanisms remain to be determined. The current study aimed at further investigating the impact of CD36 deficiency on bonę metabolism and MSCs function.

3.5 Materials and methods 3.5.1 Animals

Cd36-nuli mice on a C57BL6 background were obtained from Dr Maria Febbraio (Cleveland, Ohio) and were cross-bred at least 7 times to wild-type (WT) C57BL/6J mice purchased from Charles River (Boston, MA, USA). Ali animals were kept under a 12 h light: 12 h darkness cycle at 25°C, with free access to food and water according to protocols approved by the Ani mai Care and Use Committee of Universite du Qućbec & Montreal (#747). Cd36 genotyping was done by PCR as described previously (Luangrath et al._y 2008) using specific primers for the targeted allele    (5’-CAGCTC ATAC ATTGCTGTTTATGC ATG    and    3’-

CGCTTCCTCGTGCTTTACGGTATC). One to 9 month-old mice were used throughout the study.