5780447266

908

B. Rihn et ai

carcinogenesis (Keith et al., 1995). Both males and females spontaneously develop breast carcinomas, parotid adenocarcinomas as well as Harderian hyperplasias. However, the occurrence of these tumors is significantly increased when the mice are intoxicated by initiator or promoter agents.

Consequently the v-Ha-ra.s transgenic mice are considered as initiated mice, i.e. mice presenting a stable and heritable activation of the Ha-ras gene. Since cellular transformation is a multistep process, including loss of genetic materiał, or/and chromosome alteration, gene demethylation, impaired gene repair, oncogene acti vation and tumor suppressor gene inactivation (Vogelstein, 1989), both non-genotoxic agents and genotoxic agents are screenable with transgenic mouse models (Goldworthy et dl., 1994; Marshall, 1993) such the v-Ha-ras paradigm used in this study.

However before using such mice, it is necessary to screen them for the presence, the expression and the stability of the transgene. These initial studies are reported in the current work.

MATERIAŁ AND METHODS

Mice

Thirty transgenic mice were purchased from Charles River Laboratories (Wilmington, MA, USA) with the authorization of DuPont Company (Boston, MA, USA). This FVB/N mice strain carries the viral Harvey ras (v-Ha-rar) oncogene controlled by the mouse mammary tumor virus (MMTV) promoter. The MMTV/v-Ha-raj fusion gene contains the MMTV LTR region required for glucocorticoid contro!, promoter action and capping, and Controls the expression of the fused v-Ha-ras oncogene with activating mutations in its codons 12 and 59 (Sinn et al.> 1987).

Seven weeks old transgenic mice were randomly selccted and numbered by tattoo. Males were housed 1/cage and females 5/cage in polycarbonate cages covered with spun-bonded polyester cage filters. Room temperaturę was 21 ± 1°C, the pressure was 5 cm H₂0 above the atmospheric pressure. Relative humidity ranged from 40-60% and fluoresccnt light was 12 hrs./day. Animals were fed with pellet rations and water ad libitum.

Mice were monitored weekly for weight, appearance of palpable mammary tumors and dyspnea. Criteria for experiment termination were: appearance of tumors, dyspnea, blue tegumcnts and weight loss greater than 10% per week.

Tumor or organ specimens were fixed in Bouin’s, Clarke’s and in 4% formalin Solutions, embedded in paraffin, sectioned and stained with hematoxylin/eosin for histological examination.

DNA Extraction and Amplification

The technique described here was used for the determination of the number of transgene copies per genome equivalent, as well as for the sequencing of the v-Ha-ra5cDNA. Briefly, two tissue sections (5 pm wide) were deposited in 1.5-ml tubes and recovered with 1 ml of octane. The tubes were centrifuged at 12000 g for 5 min. and only the pellet was retained. This step was repeated and the pellet was washed once with 100% ethanol. After ethanol evaporation, 100 pl of digestion buffer (50 mM Tris#HCl, 1 mM EDTA, 1% SDS, 20 pg/ml of proteinase K (EC 3.4.21.14), pH 8.5) were added to the pellet. Samples were incubated for 3 hrs. at 55°C and proteinase K was inactivated by further hcating at 95°C for 10 min. PCR was carry out with 1 pl of supematant aliquot.

For gene copy number determination, DNA from transgenic lung was used and the primers were: i) y-Ha-ray sense primer (number4206) 5'-TACAAGCTTGTGGTGGTGGGCGCTA and antisense primer (number 4212)    5'-

GGCACTATACTCTTCTTGACCTGT; ii) c-Ha-ras sense primer 5 -CTTGGCTAAGTGTGCTTCTCATT and antisense primer 5’-CACCTCTGGCAGGTAGGCAGAGC. Controls were achieved in the absence of both antisens primers.

The polymerase chain reaction was performcd in a Minicycler™ apparatus (MJ Research, Watertown, MA, USA) with FCR™ buffer: 10mMTris»HCl, 1.5mMMgCl₂,50mM KC1,0.1 mg/ml gelatin, 0.2 mM of each dNTP, in presence of 1 pl of extracted DNA, 25 pM of primer and 1 unit of Taq DNA polymerase (EC 2.7.7.7., Bochringer, Meylan, France), pH 8.3.

The PCR™ cycles were performed as follows. First cycle: i) denaturation at 94°C for 180 sec.; ii) primer annealing at 55° forl20 sec.; iii) primer extension at 72°C for 60 sec. Twenty nine subsequent cycles followed: i) denaturation at 89°C for 90 sec.; ii) primer annealing at 55°C for 120 sec.; iii) primer extension at 72°C for 60 sec. and a 31 th cycle, with a 10 min.-period of primer extension.

cDNA Cloning and Seąuencing

Before sequencing, the amplified DNA fragments were cloned in the pBluescript II SK(+) vector using the pCR-Script SK(+) cloning kit according to the manufacturer instructions (Stratagene, La Jolla, CA, USA). Briefly, a 200 ng of a PCR insert was added to 10 pl of a ligation reaction containing 1 x universal buffer, 0.5 mM ATP and 50 ng of Sfr I-digested pCR-Script SK(+) DNA. Then the enzymes T4 DNA ligase (4U, EC 6.5.1.1.) and Sfr I were added. The reaction was allowed to proceed at room temperaturę for 1 hr. before being heat-treated at 65°C for 10 min. A 2-pl aliquot of the reaction

110