145257187

<- CS https://usegalaxy.org

“ Galaxy

Anałyze Data Workflow Shared Data- Vlsualization -

Tools

/ FastQC Read Qu ality reports (Galaxy Tool Verslon 0.63)

& Verslons ▼ Options

Jolu. Subtract and Group Fetch Alioiinifiits/Segufiifcs i: OC and manimilation

and adapter trimmer

Pear Paired-End read merger

Trimmgmitk flexible read trimming tool for Illumina N6S data

[ąstOC Read Quality report^ hiQh ąyąiitY raimiPts Build łase fluality dstributian

Short read data from

5 j «

Contaminant list

<a

D

Nothing selected

tab delimited file with 2 columns: name and seguence. For example: Illumina Smali RNA RT Primer CAAGCAGAAGACGGCATACGA Submodiile and Limit specifing file

[~d~i <g) n

Nothing selected

a file that specifies which submodules are to be executed (default-all) and aiso specifies the thresholds for the each submodules warning parameter