Physiological strains remodel extracellular matrix and cell-cell adhesion in osteoblastic cells cultured on alumina-coated titanium alloy
Fabrice Di Palmaa, Annette Chamsona, Marie-Hélène Lafage-Prousta, Paul Jouffrayb, Odile Sabidoc, Sylvie Peyrochea, Laurence Vicoa and Aline Rattner, , a
a Laboratoire de Biologie et de Biochimie du Tissu Osseux, Faculté de Médecine, Université Jean Monnet, Equipe de recherche INSERM E366, 15 rue Ambroise Paré, 42023, Saint-Etienne Cedex 02, Loire, France
b Centre de Microscopie Electronique, Ecole Nationale Supérieure des Mines de Saint-Etienne, 158 cours Fauriel, 42023, Saint-Etienne Cedex 02, France
c Centre Commun de Cytométrie de Flux, Université Jean Monnet, Faculté de Médecine, 15 rue Ambroise Paré, 42023, Saint-Etienne Cedex 02, France
Received 11 July 2003; accepted 15 September 2003. ; Available online 14 November 2003.
Biomaterials
Volume 25, Issue 13 , June 2004, Pages 2565-2575
Abstract
The effects of mechanical strains on cellular activities were assessed in an in vitro model using human osteoblastic MG-63 cells grown on titanium alloy discs coated with porous alumina and exposed to chronic intermittent loading. Strain was applied with a Dynacell® device for three 15-min sequences per day for several days with a magnitude of 600
strain and a frequency of 0.25 Hz. We have previously demonstrated that this regimen increased alkaline phosphatase activity in confluent cultures on ceramic coated titanium (alumina and hydroxyapatite) (Biomaterials 24 (2003) 3139). In this study, we analysed the production of bone matrix proteins. Osteocalcin secretion quantified by ELISA between day 5 and 11 was not affected by mechanical strain. Strain had even no quantifiable effect on collagen production from day 1 to 5 as measured by carboxy terminal collagen type I propeptide release. On the other hand, stress stimulation resulted in increased expression of fibronectin (FN) measured by Western blot after 1 day stretching. This upregulation of FN production was followed by reorganisation of the FN network after 5 days stretching observed by immunostaining. The receptors for collagen and FN,
2
1,
5
1 and
1 integrins were not quantitatively affected by the strains as measured by flow cytometry. A modification of cell morphology was seen after 5 days of loading that appeared to increase cell spreading, implying consequences on intercellular contacts. For this reason, N, C11 and E-adherins were examined. We noted a selective effect characterised by increased expression of N-cadherin using both RT-PCR and Western blot analyses. We concluded that reinforcement of cell-cell adhesion and remodelling of the FN network are important adaptive responses to physiological strains for human osteoblasts grown on alumina-coated biomaterials.
Author Keywords: Prosthetic material; Mechanical strain; Osteoblast; Fibronectin; Cadherin
Article Outline
1. Introduction
It is well established that mechanical forces induced by physical activity play a major role in the modelling and remodelling of bone tissue [1, 2, 3, 4, 5 and 6]. These forces are created during movement by muscle contractions and by impact with external objects such as the ground while walking. Bending, compression, and tension all cause bone deformation, which is quantified as strain (change in length/original length). The complex movement patterns associated with exercise result in complex strain patterns that vary in magnitude, rate, and frequency throughout the bone. In vivo experiments using strain gauges in numerous species including humans have shown that the magnitude of deformations produced on the external interface of the femur (tension) vary from 100 to 3000
[7, 8, 9, 10 and 11].
Similarly, prosthetic materials are placed in a dynamic environment after implantation. As that the first events initiated by osteoblastic cells at the implant interface are determinant for later phenomena such as proliferation, differentiation and mineralisation [12, 13, 14, 15, 16, 17, 18, 19, 20, 21 and 22], many studies have analysed the influence of the chemical composition of implants and their surface properties (rugosity, topography, wettability, energy surfaces and passivation) on osteoblast behaviour [23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 and 35]. However, all of these experiments were performed under static conditions and did not take into account the presence of mechanical deformations at the cell-implant interface and their effects on the osteoblastic phenotype.
For many years, "in vitro" studies have been performed on osteoblastic cells cultured on elastic membranes composed of polystyrene or silicone and submitted to stretching to determine the effects of mechanical strains on adhesion [36, 37, 38, 39, 40, 41, 42, 43 and 44]. These studies have more specifically investigated the role of elements such as osteocalcin (OC), type I collagen, and fibronectin (FN) that are the most representative proteins of the extracellular matrix (ECM) and the role of their integrin receptors (
2
1 for collagen type I,
5
1 for FN) in the mechanical response of osteoblastic cells [43 and 44]. However, the results presented in the literature depend on the cell line and the strain regimen, and all published studies were performed on elastic membranes with no data concerning orthopaedic biomaterials. The efficacy of orthopaedic implants requires the creation of a mechanically solid interface between the prosthetic material and bone tissue. Adhesion is a factor involved in the first phase of cell-material interactions and the quality of adhesion determines the ability of cells to proliferate and differentiate in contact with the implant. In this context, the application of mechanical loading "in vitro" can be used to determine the effects of mechanical stimulation on the synthesis and organisation of adhesion proteins.
We have consequently developed three Dynacell® devices able to induce cyclic strains on rigid biomaterials, as described in a previous study [45]. The aim of this first experiment was to determine the effects of mechanical deformations on the growth and differentiation of human osteoblastic cells. This study demonstrated that when rigid biomaterials were submitted to sequential deformations, the osteoblasts sense mechanical strains within the physiological range (600
, 0.25 Hz) and respond by an increase in alkaline phosphatase (ALP) activity [45]. In the present study, we wanted to go further and address the question of how this mechanical information is translated into an adaptive response in terms of cell morphology, cell-matrix and cell-cell adhesion.
2. Materials and methods
2.1. Biomaterial
Titanium alloy discs (TI-6Al-4V) (diameter: 90 mm) were coated by a plasma-sprayed method using an alumina powder characterised as followed:
-phase >98%, particle SIZE=5-22
m. The alumina particles were fed into an atmospheric plasma flame and projected onto the Ti-6Al-4V substrate as for hip stem prostheses preparations (SERF; Décines, France) using an automatic plasma spraying equipment (APS Sultzer-Metco). The coating consisted of porous alumina (porosity >20%,
-phase >80%), with a thickness of 100±40
m measured on a transverse section of the discs observed by light microscopy, and its arithmetic mean roughness (Ra) was 4.24±0.45
m measured by profilometry (Tactil profilometer Norm DIN, Ecole Centrale de Lyon). The discs were sterilised by
-irradiation.
2.2. Dynacell® strain instruments
The apparatus were especially designed to apply reproducible and controlled deformations on rigid biomaterials. A complete description of the Dynacell® characteristics was presented in a previous study [45]. Briefly, the devices were composed of an actuator driven by air pressure, which induces mechanical strains on biomaterials placed in a watertight chamber reserved for cell cultures. The magnitude of the strains: 600
was defined by evaluation of deformations applied to a hip stem prosthesis during walking. The frequency of deformations was determined by a cyclic load controller at 0.25 Hz. Static apparatuses were designed as simplified models only composed of a culture chamber identical to that of the Dynacell®.
2.3. Culture procedure on biomaterial and application of strain
The human cell line MG-63 (American Type Culture Collection, Rockville, MD) was chosen because it has been extensively characterised and exhibits numerous osteoblastic traits, including increased production of ALP activity and OC synthesis in response to 1,25-(OH)2D3, expression of
2
1 and
5
1 integrins specific to collagen and FN adhesion, respectively [14, 46 and 47]. The culture medium was Dulbecco's modified Eagle's medium (DMEM; BioWhittaker, Verviers, Belgium) supplemented with 2 m
-glutamine, 50 U/ml of penicillin, 50
g/ml of streptomycin and 10% foetal calf serum (FCS).
Alumina coated-discs were placed in the cell chamber of the loading system and preincubated for 15 min in culture medium. After removing the medium, the cells were plated at a density of 0.5×106 cells/disc in 10 ml of medium supplemented with 5×10−8
vitamin D3 and 50
g/ml of ascorbic acid. Cultures were maintained for 56 h before application of the strain. Cultures were reefed just before application of the first strain and then every 48 h.
The strain regimen was defined to approximately reproduce walking of an elderly person just after implantation of a hip prosthesis: a cyclic strain (600
, 0.25 Hz) was applied 3 times a day for 15 min each (225 cycles), over a period of 1, 3, or 5 days except in the experiment for OC production, in which strains were applied for 11 days. Analyses were performed 16 h after the last stimulation.
2.4. Study of cell-biomaterial interactions
2.4.1. Matrix protein synthesis
Determination of OC production by ELISA: From days 4 to 11 of mechanical stretching, cells were cultured in low serum medium (DMEM supplemented with vitamin C and D and only 0.2% of FCS). Every 48 h, samples of medium were collected in the presence of protease inhibitors and were frozen at −80°C for subsequent determinations. The OC levels were determined in duplicate by ELISA (NovoCalcin immunoassay kit) according to the manufacturer's instruction (Metra Bio-systems, Mountain View, CA). Results were expressed in ng/ml in the supernatant after correction for the background level of OC in fresh culture medium supplemented with 0.2% FCS.
Determination of collagen production by ELISA: Type I collagen content was calculated from the C-terminal propeptide (C1CP) concentration (Ref. MELKKO, 1990) in the culture medium and measured by ELISA method according to the manufacturer's instructions (Metra Biosystems, Paolo Alto, CA, USA). Each sample was run in duplicate. Values were corrected for the presence of background levels of C1CP in the fresh culture medium.
Determination of FN (210 kDa) by immunoblotting: Mouse antibodies directed against human FN were obtained from Sigma (France). The cell layer was washed twice with PBS, incubated for 5 min in 2.5 ml of cold lysis buffer (25 m
Tris pH 7.5, 150 m
NaCl, 1% IGEPAL, 5 m
EDTA, 1% sodium deoxycholate, 0.1% SDS, 50 m
NaF, 10 m
sodium pyrophosphate, 1 m
AEBSF, 0.1 U/ml of aprotinin, 10
g/ml of leupeptin, 1 m
sodium orthovanadate). The cell lysate was collected and homogenised by pipetting several times through a 22 G needle, transferred into an Eppendorf tube and kept for 30 min in ice. The supernatant was collected after centrifugation for 15 min at 10,000g. The protein content was determined by the BCA Protein Assay Kit (Pierce) [48]. Samples were boiled for 3 min. An equal amount of protein for each sample was submitted to electrophoresis on 7.5% SDS-PAGE, transferred on nitrocellulose, blocked and blotted with primary antibodies (1/2500 diluted, +4°C overnight), horseradish peroxidase secondary antibodies (1/5000, 45 min) and revealed with luminol reagents (Pierce) and Hyperfilm ECL film. Autoradiographs were scanned and the band intensity was evaluated by densitometry using Scion image software (NIH image, Version Beta2). Results were expressed as the percentage variation of band intensity between strained and unstrained cultures.
Observation of FN network by immunostaining: Cells were washed in PBS, fixed with 3% paraformaldehyde for 30 min at room temperature, washed with PBS, permeabilized for 4 min by 0.1% Triton X100 in PBS, washed with PBS, incubated for 2 h with rabbit anti-human-FN (Sigma, France) diluted to 1/100 and for 1 h with FITC-conjugated antibody (Sigma, France) diluted 1/100. Nuclei were stained by incubation for 30 min at room temperature with 0.5
g/ml DAPI (4′,6-diamino-2-phenylindole hydrochloride). Samples were mounted in Fluoprep (BioMerieux, France) and examined immediately with a fluorescence microscope (Leica, France) equipped with FITC and UV filters and a video camera.
2.4.2. Integrin receptors
Cells were released from the support by enzymatic treatment with 1 mg/ml of collagenase (type V, Sigma) and 0.25 mg/ml of trypsin, rinsed with PBS, then incubated for 90 min with mouse monoclonal antibody directed against the human integrin:
2
1 (Dako 1/10 dilution),
5
1 (Dako 1/10 dilution) or
1 subunits (Pharmingen not diluted). A negative control was prepared by replacing the antibody with irrelevant IgG. After washing, cells were labelled with goat anti-mouse IgG-FITC antibody, rinsed twice with PBS and immediately analysed by flow cytometry using an argon laser emitting 250 m
with excitation at 488 nm (Becton Dickinson FACSTAR). Specific fluorescein emission was analysed with a 530/40 nm band pass filter. Results for each time point were expressed as mean fluorescence after acquisition of 10,000 cells.
2.5. Study of the cell-cell interactions
2.5.1. Scanning electron microscopy
After 5 days of stretching, ceramics were rinsed with PBS and cultures were fixed for 30 min with glutaraldehyde solution (1%). Three successive rinses with a monosodium/dipotassium phosphate buffer solution were performed and the samples were dehydrated with acetone (10 min/bath) at increasing concentrations (30%, 50%, 70%, 80%, 90%, 95% and 99%). Discs were stored in 99.8% acetone solution at 4°C. Samples were sputtered with gold-palladium coating and examined with a scanning electron microscope (JEOL 840—Centre de Microscopie Electronique de Saint-Etienne).
2.5.2. Determination of N-, E- and C11-cadherin (130, 120 and 110 kDa) expression by immunoblotting
Mouse antibodies directed against human N-, E- and C11-cadherin were purchased from Pharmingen. Immunoblotting for N-, E- and C11-cadherins were performed with primary antibodies used at the 1/2500 dilution.
2.5.3. Determination of N- and C11-cadherin mRNA by quantitative real-time RT-PCR
Total RNA was extracted using a commercially available kit (RNeasy, Quiagen). Two-step quantitative RT-PCR was performed using the 1st strand cDNA synthesis kit (Roche Molecular Biochemicals) for the reverse transcriptase reaction and the LightCycler System® for cDNA amplification: PCR products were detected in real-time using the LightCycler-FastStart DNA master SYBR Green I reagent kit. cDNA was amplified with the following primers: 5′ ATCAACCCCATCTCAGGACA 3′ (sense) and 5′ CCATTCAGGGCATTTGGATC 3′ (antisense) were used for human N-cadherin. These primers yielded a 271 base pair (bp) product. 5′ CGTGGAGGGTTCAGTCGGCAGA 3′ (sense) and 5′ TACTGATACTCAGGTTTGAT 3′ (antisense) were used for human C11-cadherin. These primers yielded a 436 base pair product (bp). Polymerase chain reaction (PCR) for cadherin fragments was performed using the following temperatures: initial hold at 95°C for 8 min then 95°C for 15 s, 60°C for 10 s, 72°C for 18 s for 38 cycles. Real-time RT-PCR with Sybr Green dye allowed continuous monitoring of the PCR reaction as the dye intercalates with double-stranded DNA formed during the amplification stage. During the exponential phase of the amplification, samples can be compared to each other as the number of cycles required for a sample to reach arbitrary threshold fluorescence is inversely proportional to the log of the amount of transcript present in the sample. At the end of the experiments, the specificity of the products was checked by generating their melting curve on the Light Cycler system® and was confirmed by separation of these products on agarose gels.
For the quantification of PCR products, two types of controls were performed: a negative control (c−) with no target DNA and positive controls (c+) with decreasing concentrations of PCR products. A standard curve was generated for each experiment by using c+ controls. Measurement errors were evaluated less than 10%. To normalize the quantitative data, GAPDH was used as endogenous reference. GAPDH controls were obtained by using the following primers: 5′ ACCACAGTCCATGCCATCAC 3′ (sense) and 5′ TCCACCACCCTGTTGCTGTA 3′ (antisense). These primers yielded a 452 base pair product (bp). The variation of PCR product concentration between strained samples and unstrained samples was calculated according to the following formula:
|
Quantification of N- and C11-cadherin mRNA was performed with three different samples (n=3) and each sample was run in triplicate.
2.6. Statistics
All data were obtained from three separate experiments. Statistical analyses were performed with Mann-Whitney's non-parametric test for unpaired samples. The limit of significance was set at 0.05.
3. Results
3.1. Study of the cell/biomaterial interactions
3.1.1. Matrix protein
OC production: OC levels were measured after 5, 7, 9 and 11 days of stretching in the culture medium. OC production by MG-63 cells treated with 1,25-(OH)2D3 was not sensitive to mechanical stretching. The time-course of OC production showed that the OC concentration was relatively stable between day 5 and day 11 (Fig. 1).
Fig. 1. Effects of mechanical stretching on OC production. Cells were cultured for 56 h before loading. Cultures were stretched for 15 min, three times a day for 1-11 days. Unstrained (
) and strained cultures (
) were performed in parallel. OC concentrations were determined by ELISA. Results are expressed as mean±SD of the OC concentration (ng/ml) in the culture medium. Each experiment was run in triplicate (n=3).
Collagen production: Measurements performed after 2, 4 and 5 days of stretching showed that mechanical deformations had no effect on the C1CP secretion in the culture medium, and therefore did not affect type I collagen production. Note that the C1CP level decreased over time, especially at day 5 under static or dynamic conditions when the C1CP concentrations were significantly lower than during the first days of stress (Fig. 2).
Fig. 2. Effects of mechanical stretching on C1CP production. Cells were cultured for 56 h before loading. Cultures were stretched for 15 min, three times a day for 2, 4 and 5 days. Unstrained (
) and strained cultures (
) were performed in parallel. C1CP concentrations were determined by ELISA. Results are expressed as mean±SD of the C1CP concentration (
g/ml) in the culture medium. Each experiment was run in triplicate (n=3).
FN production: Immunoblot analysis showed that FN production was significantly increased (p<0.05) by 60% after the first day of stretching. However, this effect was only observed during the early phase of dynamic culture, followed by normalisation after a longer exposure to stretch (day 3). The ECM protein level reached the control level at day 5 (Fig. 3).
Fig. 3. Effects of mechanical stretching on the FN (MW=210 kDa) production. Cells were cultured for 56 h before loading. Cultures were stretched for 15 min, three times a day for 1, 3 and 5 days. Unstrained (
) and strained cultures (
) were performed in parallel. FN production was determined by immunoblotting. Results for strained substrates are expressed as % of FN in unstrained controls. Each experiment was run in triplicate (n=3).
FN fibrillogenesis: An increased fluorescent intensity was observed in the cultures after 1 day of stretching, confirming the increased FN production quantified by immunoblotting. Immunofluorescent staining also provided more information about the organisation of the FN. The network at the alumina-coated disc interface did not appear to be affected after 1 and 3 days of stretching, but a marked decrease in the number of FN fibres was observed after 5 days of stretching. The thickness of FN fibres also increased in strained cultures compared with control cultures. DAPI staining of the cell nuclei confirmed that the differences of FN networks between static and dynamic conditions were only due to mechanical deformations and not to a variation of the cell density (Fig. 4).
Fig. 4. Effects of mechanical stretching on the FN network organisation. Cells were cultured for 56 h before loading. Cultures were stretched for 15 min, three times a day for 1, 3 and 5 days. Unstrained and strained cultures were performed in parallel. The FN network was visualised by immunofluorescence staining. Cell nuclei were visualised by DAPI staining. Each disc was thoroughly examined. Fifty pictures were taken under static and dynamic conditions.
3.1.2. Integrin receptors
Quantification of integrin receptors after 1, 3 and 5 days of stretching demonstrated that mechanical deformations had little effect on the amount of
1 integrin subunits,
2
1 (collagen I receptor) and
5
1 (FN receptor) integrins at the cell surface (Fig. 5).
Fig. 5. Effects of mechanical stretching on the expression of
2
1,
5
1 integrin receptors and
1 integrin subunits. Cells were cultured for 56 h before loading. Cultures were stretched for 15 min, three times a day for 1, 3 and 5 days. Unstrained (
) and strained cultures (
) were performed in parallel. Integrin expression was determined by immunofluorescence and flow cytometry analysis of 10,000 events for each sample. Results are expressed as mean of fluorescent intensity (MFI) by cell, normalised by the MFI of the negative control. Each experiment was run in triplicate (n=3).
3.2. Study of cell-cell interactions
3.2.1. Cell morphology by SEM
MG-63 cells cultured on alumina-coated discs were visualised after 5 days of stretching and compared to static cultures. The cell number was the same in both conditions as it was demonstrated previously [45]. However, the cell layer was composed of more cell-cell contacts in strained cultures compared to unstrained cultures. The difference could be explained by the fact that MG-63 cells may be more spread out after stretching and covered the totality of the biomaterial surface in contrast with static cultures where the area occupied by cells appeared to be smaller, leaving the ceramic surface exposed ( Fig. 6).
Fig. 6. S.E.M visualisation of the morphology of MG-63 cells cultured under static and dynamic conditions on alumina-coated discs (magnification ×800). Cells were cultured for 56 h before loading. Cultures were stretched for 15 min, three times a day for 5 days. Unstrained (U) and strained cultures (S) were performed in parallel. This experiment was run in triplicate (n=3) and each disc was thoroughly examined. Pictures taken under static and dynamic conditions were compared.
3.2.2. N-, E- and C11-cadherin expression
Immunoblotting analyses demonstrated that N-cadherin expression was not modified after 1 and 3 days of stretching, but quantification of the 130 kDa band showed a significant increase by approximately 37% after 5 days (Fig. 7). E-cadherin was not expressed by MG-63 cells under either static or dynamic conditions. No effect of mechanical strains was observed on C11-cadherin expression after 1, 3 and 5 days of stretching (Fig. 8).
Fig. 7. Effects of mechanical stretching on N-cadherin (MW=130 kDa) expression. Cells were cultured for 56 h before loading. Cultures were stretched for 15 min, three times a day for 1, 3 and 5 days. Unstrained (
) and strained cultures (
) were performed in parallel. N-cadherin expression was determined by immunoblotting. Results for strained substrates are expressed as % of N-cadherin in unstrained controls. Each experiment was run in triplicate (n=3).
Fig. 8. Effects of mechanical stretching on C11-cadherin (MW=120 kDa) expression. Cells were cultured for 56 h before loading. Cultures were stretched for 15 min, three times a day for 1, 3 and 5 days. Unstrained (
) and strained cultures (
) were performed in parallel. C11-cadherin expression was determined by immunoblotting. Results for strained substrates are expressed as % of C11-cadherin in unstrained controls. Each experiment was run in triplicate (n=3).
3.2.3. N- and C11-cadherin mRNA expression
The expression of mRNA coding for N- and C11-cadherins was determined after 5 days of stretching. PCR experiments showed that three splicing variants of N-cadherin and two splicing variants of C11-cadherins were expressed by MG-63 cells. These results were obtained by melting curve and confirmed by agarose gels analyses (Fig. 9 and Fig. 10). It is also important to note that the quantification of both N- and C11-cadherins was performed on the totality of their splicing variants, as the role of each variant is unknown. The comparison of strained and unstrained samples showed that 5 days of mechanical stretching significantly increased N-cadherin mRNA expression by 34% (Fig. 9), but had no effect on C11-cadherin mRNA expression ( Fig. 10).
Fig. 9. Effects of mechanical stretching on N-cadherin mRNA expression. Cells were cultured for 56 h before loading. Cultures were stretched for 15 min, three times a day for 5 days. Unstrained (
) and strained cultures (
) were performed in parallel. N-cadherin mRNA expression was determined by quantitative real-time RT-PCR using the Light-Cycler system®. For the GAPDH and N-cadherin PCR, a melting curve and a standard curve were generated to demonstrate the purity of the PCR products (using negative controls (c−) and positive controls (c+)) and the linear correlation between mRNA concentrations in the positive controls (c+) and the number of cycles. N-cadherin mRNA concentrations of each sample were normalised by the GAPDH mRNA concentrations present in the same samples. Results for strained substrates are expressed as % of N-cadherin mRNA in unstrained controls. Each experiment was run in triplicate (n=3).
Fig. 10. Effects of mechanical stretching on the C11-cadherin mRNA expression. Cells were cultured for 56 h before loading. Cultures were stretched for 15 min, three times a day for 5 days. Unstrained (
) and strained cultures (
) were performed in parallel. C11-cadherin mRNA expression was determined by quantitative real-time RT-PCR using the Light-Cycler system®. For the GAPDH and C11-cadherin PCR, a melting curve and a standard curve were generated to demonstrate the purity of the PCR products (using negative controls (c−) and positive controls (c+)) and the linear correlation between mRNA concentrations in the positive controls (c+) and the number of cycles. C11-cadherin mRNA concentrations of each sample were normalised by the GAPDH mRNA concentrations present in the same samples. Results for strained substrates are expressed as % of C11-cadherin mRNA in unstrained controls. Each experiment was run in triplicate (n=3).
4. Discussion
A wide variety of laboratory apparatuses have been devised for mechanical stimulation of cell cultures, but none of these devices are adapted to hard substrates such as those used in orthopaedic surgery. We have previously described a new loading system, the Dynacell®, which delivers physiological strains on various orthopaedic biomaterials. We demonstrated that after exposure to short and repeated stimulations, this mechanical stimulation induced differentiation in terms of ALP for human osteoblast-like cells and MG-63 cells on all substrates tested [45]. Among the various ceramic coatings, plasma-spray application of aluminium oxide (Al2O3) has been widely used in clinical applications. Alumina-coated titanium alloy was therefore used in this study to provide insight into the cellular responses to mechanical stimuli in order to define which bone cell activities are affected by this strain regimen.
OC production by stressed cultures was determined, as this marker represents a later stage of osteoblast development than ALP. Under our study conditions, a cyclic strain at a physiological magnitude did not affect the OC level even after prolonged exposure for 11 days of stimulation. This phenomenon has also been observed by Carvalho et al. [37] using a biaxial strain with the same order of magnitude (1.3%), applied with the same frequency as in our study (0.25 Hz) on human osteoblasts grown on flexible membranes. In contrast, Kaspar et al. [40] noted a decrease of OC gene expression for the same cellular model at a subconfluent state.
The possible modification of cell-material interactions in response to physiological stress was evaluated by examining the cellular receptors involved in osteoblast adhesion as well as their ligands. Osteoblasts express ECM receptors which couple mechanical stimuli to functional responses. Integrin receptors are composed of various combinations of
and
chains. Depending on the combinations of these chains, these heterodimeric receptors have been shown to specifically bind to various ECM proteins. It has been demonstrated that osteoblast integrin expression is regulated by orthopaedic implant material [19]. In the present study, we considered
5
1 integrins that are a specific receptor for FN and
2
1 integrins that are specific for collagen. We did not observe any activation of
2
1 or
5
1 integrins in response to physiological mechanical stimuli in terms of an increase in the number of receptors as quantified by flow cytometry. These results were consistent with Yano et al. that found no change of
2,
5, and
1 integrin expression after cyclic strain of endothelial cells on a flexible membrane [49]. It is not excluded that the integrins may have been activated by mechanical stimulation with a clustering in focal contact structures. Carvalho et al. [44] showed that human osteosarcoma (HOS) TE-85 cells stressed with the Flexercell apparatus significantly increased
1 mRNA expression at 30 min and 3 days of strain application, associated with a marked modification of the
1 integrin distribution in 24-h cultures. In our case, the marked roughness of the substrate did not allow a correct observation of these structures by immunostaining. Complementary experiments are in progress using a smooth substrate to visualise the distribution of integrins in response to physiological stress.
FN and type I collagen are the two major ECM proteins that may transmit information from the bone ECM to the osteoblast. In our model, type I collagen, which is a non-RGD protein like OC, was not affected by the strain. Divergent in vitro results demonstrate that the modalities of the strain (frequency, duration, number of cycles) influence the bone cell response [50]. Under certain stress conditions, osteoblasts can respond by an increase in collagen synthesis. For example, Kaspar et al. [40] demonstrated that cyclic strain at a physiological magnitude resulted in an increase in proliferation and C1CP release by human osteoblast-like cells. Another possibility is that, in our experiments, cells were seeded 56 h before loading, at a time when deposition of ECM components is already considerable and the cells did not subsequently increase their collagen matrix in response to stress. Moreover, in the in vitro models of mechanical stimulation, increased proliferation is often associated with other early osteoblast activities, such as collagen production. For example, after cyclic stretching of MC3T3 cells, Stanford et al. [51] showed an increase of proliferation concurrent to stimulation of CICP release. In contrast, the stress regimen applied in this study to MG-63 cells cultured on alumina-coated biomaterial had no effect on either collagen secretion or proliferation.
FN, the other main ECM protein secreted by osteoblasts, is a cell adhesion protein produced in an inactive globular state and then assembled by the cell into an insoluble, high-molecular-weight fibre. In its fibrillary state, FN plays a central role in regulating cell adhesion, proliferation and differentiation. Assembly of FN into fibrillary matrix is a complex process involving multiple steps. Fibrillogenesis is not a spontaneous process, as the cells actually perform a "knitting" function to assemble the FN-rich ECM around them [52]. Our study indicated that endogenous FN matrix deposition on an alumina-coated substratum was rapidly and transiently increased at day 1 compared to static cultures. This upregulation of FN by mechanical stress has also been reported in other studies [41 and 37]. This difference progressively declined so that similar FN levels were seen between stimulated and static cultures. Interestingly, this mechanically induced upregulation of ECM production was followed by an increase of extracellular FN fibrillogenesis. A reorganisation of the network after 5 days of stress was observed with thickening of the fibres. Altogether these observations suggest that the mechanical signal induced a cellular response leading to reinforcement of the cell-matrix interactions. Changes in FN expression were observed for short durations of mechanical stimulation, and a change in FN organisation was observed corresponding to long-term adaptation to prolonged mechanical stimulation.
In addition to a change in FN organisation, a modification of cell morphology was also observed after 5 days of loading. Visualisation of the cell layer by SEM demonstrated an increase in cell spreading, suggesting the hypothesis that the intercellular contacts could be affected by stress. Osteoblasts have been shown to develop well-defined structures such as gap junctions and adherent junctions in response to physical contacts. The main adhesion receptors in adherent junctions are the cadherins, a family of transmembrane glycoproteins that mediate calcium-dependent cell-cell adhesion. These structural proteins are also connected to the cytoskeleton via other proteins, such as catenin (
,
and
). Human osteoblasts have been shown to express a repertoire of cadherins which are critical during differentiation [53 and 54]. Among the various types of cadherins, we examined the effect of stretching on N and C11-cadherins which are the most representative cadherins of the osteoblastic phenotype [55] and E-cadherins expressed in some osteoblast cell lines [56]. The advantage of using real-time PCR to analyse mRNA coding for cadherins is its great sensitivity and this method demonstrated that MG-63 cells expressed three transcripts coding for N-cadherin and two transcripts for C11-cadherins. The presence of 2 or 3 variants of N-cadherin in human osteoblasts [53 and 54] and 1 spliced variant for C11-cadherin has also been described in various species [53 and 57]. N-cadherin is a surface molecule intimately involved in osteoblast differentiation and function [54 and 58]. Our study showed that mechanical deformations significantly increased N-cadherin expression of MG-63 cells from 20% to 50% after 5 days of stretching. These results are in line with those reported by other authors [59 and 60], who have demonstrated, in other cell cultures, myocytes and tendon cells, respectively, that mechanical stains increased the level of N-cadherins. In contrast, the influence of mechanical deformations on C11-cadherin expression was not observed. The function of individual cadherins in osteoblasts remains to be elucidated. Cadherin-11 is widely expressed in mesenchymal cells [57] and is also abundant in bone cells, and its expression does not seem to change notably during differentiation [55]. This cadherin does not appear to be significantly altered by regulators of bone formation, such as rhBMP-2 [53] or TNF-
[61]. C11 is probably less sensitive to bone remodelling regulators than N-Cadherin. For E-cadherin, immunoblotting analyses showed that this type of CAM was not expressed by MG-63 cells and that mechanical strain did not induce their expression. Our results demonstrated that the increase of cell-cell contacts observed by SEM after mechanical stimulation was associated with enhanced cadherin expression with a selective effect on N-cadherin expression.
In addition to the generally accepted role of integrins as mediators for mechanotransduction, this study supports a role for N-cadherin as another mechanosensor. These results raise the speculation that enhanced cadherin synthesis may be necessary to provide cells with the structural means to increase their attachment to each other in response to application of strain.
5. Conclusion
The combination of cell morphological changes, increased cell-cell adhesion and an early increase in FN synthesis combined with late FN network reorganisation for osteoblastic cells cultured on the biomaterial constitutes an important adaptive response to mechanical strain of physiological magnitude. This cell behaviour appears to lead to reinforcement of both cell-cell interactions and cell-matrix interactions.
Acknowledgements
The authors would like to thank the SERF society for providing biomaterial and financing the Dynacell® strain devices and the Laboratoire de Mécanique des Biomatériaux et Traitement de Surface de l'Ecole Nationale Supérieure des Mines de Saint-Etienne for his help in the characterization of the biomaterial. This research was supported by la Région Rhône-Alpes.
References
1. H.M. Frost, Perspectives: bone's mechanical usage windows. J Bone Mineral Res 19 (1992), pp. 257-271. Abstract
2. L. Lanyon, Functional strains as a determinant for bone remodelling. Calcif Tissue Int 36 (1984), pp. 556-561.
3. L.E. Lanyon and C.T. Rubin, Static vs. dynamic loads as an influence on bone remodelling. J Biomech 17 (1984), pp. 897-905. Abstract
4. P.J. Ehrlich and L.E. Lanyon, Mechanical strain and bone cell functions: a review. Osteoporosis Int 13 (2002), pp. 688-700. Abstract-MEDLINE | Abstract-EMBASE | Full Text via CrossRef
5. D.B. Burr, A.G. Robling and C.H. Turner, Effects of biomechanical stress on bones in animals. Bone 30 (2002), pp. 781-786. SummaryPlus | Full Text + Links | PDF (240 K)
6. A.G. Robling and C.H. Turner, Mechanotransduction in bone: genetic effects on mechanosensitivity in mice. Bone 31 (2002), pp. 562-569. SummaryPlus | Full Text + Links | PDF (262 K)
7. D.B. Burr, C. Milgrom, D. Fyhrie, M. Forwood, M. Nyska, A. Finestone, S. Hoshaw, E. Saiag and A. Simkin, In vivo measurement of human tibial strains during vigorous activity. Bone 18 (1996), pp. 405-410. SummaryPlus | Full Text + Links | PDF (561 K)
8. L.E. Lanyon, W.G.J. Hampson, A.E. Goodship and J.S. Shah, Bone deformation recorded in vivo from strain gauges attached to the human tibial shaft. Acta Orthop Scand 46 (1975), pp. 256-268. Abstract-EMBASE | Abstract-MEDLINE
9. K.C.L. Lee, A. Maxwell and L.E. Lanyon, Validation of a technique for studying functional adaptation of the mouse ulna in response to mechanical loading. Bone 31 (2002), pp. 0001-0009.
10. C.T. Rubin, Skeletal strain and the functional significance of bone architecture. Calcif Tissue Int 36 (1984), pp. S11-S18. Abstract-EMBASE | Abstract-MEDLINE
11. B. Demes, Y. Quin, J.T. Stern, Jr, S.G. Larson and C.T. Rubin, Patterns of strain in the macaque tibia during functional activity. Am J Phys Anthropol 116 (2001), pp. 257-265. Abstract-MEDLINE | Abstract-EMBASE | Full Text via CrossRef
12. D.A. Puelo and R. Bizios, Formation of focal contacts by osteoblasts cultured on orthopaedic biomaterials. J Biomed Mater Res 26 (1992), pp. 291-301.
13. R.K. Sinha, S.A. Shah and R.S. Tuan, Surface composition of orthopaedic implant metals regulates cell attachment, spreading, and cytoskeletal organization of primary human osteoblasts in vitro. Clin Orthop 305 (1994), pp. 258-272. Abstract-MEDLINE | Abstract-EMBASE
14. J. Lincks, B.D. Boyan, C.R. Blanchard, C.H. Lohmann, Y. Liu, D.L. Cochran, D.D. Dean and Z. Schwartz, Response of MG-63 osteoblast-like cells to titanium and titanium alloy is dependent on surface roughness and composition. Biomaterials 19 (1998), pp. 2219-2232. Abstract | PDF (752 K)
15. A. Okumura, M. Goto, T. Goto, M. Yoshinari, S. Masuko, T. Katsuki and T. Tanaka, Substrate affects the initial attachment and subsequent behaviour of human osteoblastic cells (Saos-2). Biomaterials 22 (2001), pp. 2263-2271. SummaryPlus | Full Text + Links | PDF (355 K)
16. U. Geissler, U. Hempel, C. Wolf, D. Scharnweber and H. Worch, Wenzel, Collagen type I-coating of Ti-6Al-4V promotes adhesion of osteoblasts. J Biomed Mater Res 15 (2000), pp. 752-760. Abstract-MEDLINE | Abstract-Compendex
17. C. Roehlecke, M. Witt, M. Kasper, E. Schulze, C. Wolf, A. Hofer and R.W. Funk, Synergistic effect of titanium alloy and collagen type I on cell adhesion, proliferation and differentiation of osteoblast-like cells. Cells Tissues Organs 168 (2001), pp. 178-187. Abstract-MEDLINE | Abstract-Elsevier BIOBASE | Abstract-EMBASE | Full Text via CrossRef
18. M. Ahmad, M.B. McCarthy and G. Gronowicz, An in vitro model for mineralization of human osteoblast-like cells on implant materials. Biomaterials 20 (1999), pp. 211-220. Abstract | PDF (890 K)
19. R.K. Sinha and R.S. Tuan, Regulation of human osteoblast integrin expression by orthopaedic implant materials. Bone 18 (1996), pp. 451-457. SummaryPlus | Full Text + Links | PDF (655 K)
20. E.A. Cowles, L.L. Brailey and G.A. Gronowicz, Integrin-mediated signalling regulates AP-1 transcription factors and proliferation in osteoblasts. J Biomed Mater Res 52 (2000), pp. 725-737. Abstract-MEDLINE | Abstract-EMBASE | Abstract-Compendex | Full Text via CrossRef
21. A. Krause, E.A. Cowles and G. Gronowicz, Integrin-mediated signalling in osteoblasts on titanium implants materials. J Biomed Mater Res 52 (2000), pp. 738-747. Abstract-MEDLINE | Abstract-EMBASE | Abstract-Compendex | Full Text via CrossRef
22. A. Renazia and K.E. Healy, Biomimetic peptide surfaces that regulate adhesion, spreading, cytoskeletal organization, and mineralization of the matrix deposited by osteoblast-like cells. Biotechnol Prog 15 (1999), pp. 19-32.
23. M. Ahmad, D. Gawronski, J. Blum, J. Goldberg and G. Gronowicz, Differential response of human osteoblast-like cells to commercially pure (cp) titanium grades 1 and 4. J Biomed Mater Res 46 (1999), pp. 121-131. Abstract-EMBASE | Abstract-MEDLINE | Full Text via CrossRef
24. H. Zreiqat and C.R. Howlett, Titanium substrata composition influences osteoblastic phenotype: in vitro study. J Biomed Mater Res 47 (1999), pp. 360-366. Abstract-MEDLINE | Abstract-EMBASE | Abstract-Compendex | Full Text via CrossRef
25. K. Anselme, P. Linez, M. Bigerelle, A. Le Maguer, P. Hardouin, H.F. Hildebrand, A. Iost and J.M. Leroy, The relative influence of the topography and chemistry of Ti-6Al-4V surfaces on osteoblastic cell behaviour. Biomaterials 21 (2000), pp. 1567-1577. SummaryPlus | Full Text + Links | PDF (1813 K)
26. P.A. Ramires, A. Romito, F. Cosentino and E. Milella, The influence of titania/hydroxyapatite composite coatings on in vitro osteoblasts behaviour. Biomaterials 22 (2001), pp. 1467-1474. SummaryPlus | Full Text + Links | PDF (422 K)
27. J.Y. Martin, Z. Schwartz, T.W. Hummert, D.M. Schraub, J. Simpson, J. Lankford, Jr, D.D. Dean, D.L. Cochran and B.D. Boyan, Effect of titanium surface roughness on proliferation, differentiation, and protein synthesis of human osteoblast-like cells (MG-63). J Biomed Mater Res 29 (1995), pp. 389-401. Abstract-MEDLINE | Abstract-EMBASE | Abstract-Compendex
28. K. Kieswetter, Z. Schwartz, T.W. Hummert, D.L. Cochran, J. Simpson, D.D. Dean and B.D. Boyan, Surface roughness modulates the local production of growth factors and cytokines by osteoblast-like MG-63 cells. J Biomed Mater Res 32 (1996), pp. 55-63. Abstract-MEDLINE | Full Text via CrossRef
29. C.H. Lohmann, E.M. Tandy, V.L. Sylvia, A.K. Hell-Vocke, D.L. Cochran, D.D. Dean, B.D. Boyan and Z. Schwartz, Response of normal female human osteoblasts (NHOst) to 17
-estradiol is modulated by implant surface morphology. J Biomed Mater Res 62 (2002), pp. 204-213. Abstract-MEDLINE | Abstract-EMBASE | Full Text via CrossRef
30. U. Noth, C. Hendrich, D. Scheddin, T. Altvater, J. Eulert and R. Thull, Effect of titanium surfaces of various roughnesses on cell proliferation cell differentiation and protein synthesis of fetal osteoblasts (hFOB 1.19). Biomed Tech 42 (1997), pp. 367-368. Abstract-MEDLINE
31. I. Degasme, M.F. Basle, V. Demais, G. Hure, M. Lesourd, B. Grolleau, L. Mercier and D. Chappard, Effects of roughness, fibronectine and vitronectin on attachment, spreading, and proliferation of human osteoblast-like cells (Saos-2) on titanium surfaces. Calcif Tissue Int 64 (1999), pp. 499-507.
32. S.A. Redey, M. Nardin, D. Bernache-Assolant, C. Rey, P. Delannoy, L. Sedel and P.J. Marie, Behavior of human osteoblastic cells on stoichiometric hydroxyapatite and type A carbonate apatite: role of surface energy. J Biomed Mater Res 50 (2000), pp. 353-364. Abstract-MEDLINE | Abstract-EMBASE | Abstract-Compendex | Full Text via CrossRef
33. M. Ohgaki, T. Kizuki, M. Katsura and K. Yamashita, Manipulation of selective cell adhesion and growth by surface charges of electrically polarized hydroxyapatite. J Biomed Mater Res 57 (2001), pp. 366-373. Abstract-MEDLINE | Abstract-EMBASE | Full Text via CrossRef
34. I. Yanagisawa, H. Sakuma, M. Shimura, Y. Wakamatsu, S. Yanagisawa and E. Sairenji, The effects of "wettability" of biomaterials on culture cells. Oral Implantol 15 3 (1989), pp. 168-177. Abstract-MEDLINE
35. J. Pan, H. Liao, C. Leygraf, D. Thierry and J. Li, Variation of oxide films on titanium induced by osteoblast-like cell culture and the influence of an H2O2 pretreatment. J Biomed Mater Res 40 (1998), pp. 244-256. Abstract-MEDLINE | Abstract-EMBASE | Full Text via CrossRef
36. M.E. Lacouture, J.L. Schaffer and L.B. Klickstein, A comparison of type I collagen, fibronectine, and vitronectin in supporting adhesion of mechanically strained osteoblasts. J Bone Miner Res 17 (2002), pp. 481-492. Abstract-MEDLINE | Abstract-EMBASE
37. R.S. Carvalho, A. Bumann, J.L. Schaffer and L.C. Gerstenfeld, Predominant integrin ligands expressed by osteoblasts show preferential regulation in response to both cell adhesion and mechanical perturbation. J Cellular Biochem 84 (2002), pp. 497-508. Abstract-MEDLINE | Full Text via CrossRef
38. L.V. Harter, K.A. Hruska and R.L. Duncan, Human osteoblast-like cells respond to mechanical strain with increased bone matrix protein production independent of hormonal regulation. Endocrinology 136 (1995), pp. 528-535. Abstract-MEDLINE | Abstract-Elsevier BIOBASE | Abstract-EMBASE | Full Text via CrossRef
39. M. Wozniak, A. Fausto, C.P. Carron, D.M. Meyer and K.A. Hruska, Mechanically strained cells of the osteoblast lineage organize their extracellular matrix through unique sites of alphavbeta3-integrin expression. J Bone Miner Res 15 (2000), pp. 1731-1745. Abstract-MEDLINE | Abstract-EMBASE
40. D. Kaspar, W. Seidl, C. Neidlinger-wilke, A. Ignatius and L. Claes, Dynamic cell stretching increases human osteoblast proliferation and C1CP synthesis but decreases osteocalcin synthesis and alkaline phosphatase activity. J Biomech 33 (2000), pp. 45-51. SummaryPlus | Full Text + Links | PDF (162 K)
41. M.C. Meazzini, C.D. Toma, J.L. Schaffer, M.L. Gray and L.C. Gerstenfeld, Osteoblast cytoskeletal modulation in response to mechanical strain in vitro. J Orthop Res 16 (1998), pp. 170-180. Abstract-MEDLINE | Abstract-Compendex | Abstract-EMBASE
42. U. Meyer, T. Meyer and D.B. Jones, No mechanical role for vinculin in strain transduction in primary bovine osteoblasts. Biochem Cell Biol 75 (1997), pp. 81-87. Abstract-MEDLINE | Full Text via CrossRef
43. C. Schmidt, H. Pommerenke, F. Dürr, B. Nebe and J. Rychly, Mechanical stressing of integrin receptors induces enhanced tyrosine phosphorylation of cytoskeletally anchored proteins. J Biol Chem 273 (1997), pp. 5081-5085.
44. R.S. Carvalho, J.E. Scott and E.H.K. Yen, The effects of mechanical stimulation on the distribution of
1 integrin and expression of
1 integrin mRNA in TE-85 human osteosarcoma cells. Archs oral Biol 40 (1995), pp. 257-264. SummaryPlus | Full Text + Links | PDF (961 K)
45. F. Di Palma, M. Douet, C. Boachon, A. Guignandon, S. Peyroche, B. Forest, C. Alexandre, A. Chamson and A. Rattner, Physiological strains induce differentiation in human osteoblasts cultured on orthopaedic biomaterial. Biomaterials 24 (2003), pp. 3139-3151. SummaryPlus | Full Text + Links | PDF (431 K)
46. R.T. Franceschi and J. Young, Regulation of alkaline phosphatase by 1,25-dihydroxyvitamin D3 and ascorbic acid in bone derived cells. J Bone Miner Res 5 (1990), pp. 1157-1167. Abstract-MEDLINE | Abstract-EMBASE
47. J. Clover and M. Cowen, Are MG-63 and HOS TE-85 human osteosarcoma cell lines representative models of the osteoblastic phenotype?. Bone 15 (1994), pp. 585-591. Abstract-MEDLINE | Abstract-Elsevier BIOBASE | Abstract-EMBASE
48. P.K. Smith, R.I. Krohn, G.T. Hermanson, A.K. Mallia, F.H. Gartner, M.D. Provenzano, E.K. Fujimoto, N.M. Goeke, B.J. Olson and D.C. Klenk, Measurement of protein using bicinchoninic acid. Anal Biochem 150 (1985), pp. 76-85. Abstract-EMBASE | Abstract-MEDLINE
49. Y. Yano, J. Geibel and E. Sumpio, Cyclic strain induces reorganization of integrin
5
1 and
2
1 in human umbilical vein endothelial cells. J Cell Biochem 64 (1997), pp. 505-513. Abstract-MEDLINE | Full Text via CrossRef
50. D. Kaspar, W. Seidl, C. Neidlinger-Wilke, A. Beck, L. Claes and A. Ignatius, Proliferation of human-derived cells depends on the cycle number and frequency of uniaxial strain. J Biomech 35 (2002), pp. 873-880. SummaryPlus | Full Text + Links | PDF (124 K)
51. C.M. Stanford, J.A. Morcuende and R.A. Brand, Proliferative and phenotypic responses of bone-like cells to mechanical deformation. J Orthop Res 13 (1995), pp. 664-670. Abstract-MEDLINE | Abstract-EMBASE | Abstract-Compendex
52. R.O. Hyned, The dynamic dialogue between cells and matrices: implications of fibronectin's elasticity. Proc Nat Acad Sci USA 96 (1999), pp. 2588-2590.
53. S.L. Cheng, F. Lecanda, M.K. Davidson, P.M. Warlow, S.F. Zhang, L. Zhang, S. Suzuki, T. St John and R. Civitelli, Human osteoblasts express a repertoire of cadherins, which are critical for BMP-2-induced osteogenic differentiation. J Bone Miner Res 13 (1998), pp. 633-644. Abstract-MEDLINE | Abstract-EMBASE
54. S.L. Ferrari, K. Traianedes, M. Thorne, M.H. Lafage-Proust, P. Genever, M.G. Cecchini, V. Behar, A. Bisello, M. Chorev, M. Rosenblatt and L.J. Suva, A role for N-cadherin in the development of the differentiated osteoblastic phenotype. J Bone Miner Res 15 (2000), pp. 198-208. Abstract-MEDLINE | Abstract-EMBASE
55. F. Lecanda, S.L. Cheng, C.S. Shin, M.K. Davidson, P. Warlow, L.V. Avioli and R. Civitelli, Differential regulation of cadherins by dexamethasone in human osteoblastic cells. J Cell Biochem 77 (2000), pp. 499-506. Abstract-EMBASE | Abstract-MEDLINE | Full Text via CrossRef
56. E. Hay, J. Lemonnier, D. Modrowski, A. Lomri, F. Lasmoles and P.J. Marie, N- and E-cadherin mediate early human calvaria osteoblast differenciation promoted by bone morphogenetic protein-2. J Cellular Physiol 183 (2000), pp. 117-128. Abstract-Elsevier BIOBASE | Abstract-EMBASE
57. J. Kawaguchi, I. Kii, Y. Sugiyama, S. Takeshita and A. Kudo, The transition of cadherin expression in osteoblast differentiation from mesenchymal cells: consistent expression of cadherin-11 in osteoblast lineage. J Bone Miner Res 16 (2001), pp. 260-269. Abstract-MEDLINE | Abstract-EMBASE
58. P.J. Marie, Role of N-cadherin in bone formation. J Cell Physiol 190 (2002), pp. 297-305. Abstract-EMBASE | Abstract-Elsevier BIOBASE | Abstract-MEDLINE | Full Text via CrossRef
59. J. Zhuang, K.A. Yamada, J.E. Saffitz and A.G. Kléber, Pulsatile stretch remodels cell-to-cell communication in cultured myocytes. Cir Res 87 (2000), pp. 316-322. Abstract-MEDLINE | Abstract-Elsevier BIOBASE | Abstract-EMBASE
60. J.R. Ralphs, A.D. Waggett and M. Benjamin, Actin stress fibres and cell-cell adhesion molecules in tendons: organisation in vivo and response to mechanical loading of tendon cells in vitro. Matrix Biol 21 (2002), pp. 67-74. SummaryPlus | Full Text + Links | PDF (2607 K)
61. T. Tsutsumimoto, S. Kawasaki, S. Ebara and K. Takaoka, TNF-alpha and IL-1beta suppress N-cadherin expression in MC3T3 cells. J Bone Miner Res 14(1999), pp. 1751-1760. Abstract-MEDLINE | Abstract-EMBASE
Wyszukiwarka
Podobne podstrony:
Extracellular NAD and ATP Partners in immune
[15]Reactive oxygen species, cell signaling, and cell injury
Apoptosis, Cytotoxicity and Cell Proliferation
Morphogenesis and cell cycle progression in Candida albicans
Influence of extraction parameters and medium on efficiency
Matrix and Philosophy William Irwin, ed
Hydrogels as Extracellular Matrix Mimics for
Optimization of Extraction Conditions and Fiber Selection fo
Role of extracellular matrix in acupoint region in acupunctu
[15]Reactive oxygen species, cell signaling, and cell injury
Extracting heat and energy from vacuum
Extracellular NAD and ATP Partners in immune
Apoptosis, Cytotoxicity and Cell Proliferation
Apoptosis, Cytotoxicity and Cell Proliferation
Aerobic granules with inhibitory strains and role of extracellular polymeric substances
Aerobic granules with inhibitory strains and role of extracellular polymeric substances
Applications and opportunities for ultrasound assisted extraction in the food industry — A review
Extract from Armoracia rusticana and Its Flavonoid Components
Cytotoxicity of Aqueous and Ethanolic Extracts
więcej podobnych podstron