Peroxidase-dependent apoplastic oxidative burst in
Arabidopsis required for pathogen resistance

Laurence V. Bindschedler

1,†

, Julia Dewdney

2

, Kris A. Blee

1,‡

, Julie M. Stone

2,§

, Tsuneaki Asai

2,–

, Julia Plotnikov

2

, Carine

Denoux

2

, Tezni Hayes

1

, Chris Gerrish

1

, Dewi R. Davies

1

, Frederick M. Ausubel

2

and G. Paul Bolwell

1,*

1

School of Biological Sciences, Royal Holloway, University of London, Egham, Surrey TW20 0EX, UK, and

2

Department of Genetics, Harvard Medical School and Department of Molecular Biology, Massachusetts General Hospital,

Boston, MA 02114, USA

Received 5 April 2006; accepted 26 May 2006.

*

For correspondence (fax

þ44 1784 443239; e-mail [e-mail]).

†

Present address: The BioCentre, University of Reading, Reading RG6 6AS, UK.

‡

Present address: Department of Biological Sciences, California State University, Chico, CA 95929, USA.

§

Present address: Biochemistry Department, University of Nebraska, Lincoln, NE 68588-0664, USA.

–

Present address: Department of Molecular Life Sciences, Tokai University School of Medicine, Kanagawa 259-1193, Japan.

Summary

The oxidative burst is an early response to pathogen attack leading to the production of reactive oxygen
species (ROS) including hydrogen peroxide. Two major mechanisms involving either NADPH oxidases or
peroxidases that may exist singly or in combination in different plant species have been proposed for the
generation of ROS. We identified an Arabidopsis thaliana azide-sensitive but diphenylene iodonium-
insensitive apoplastic oxidative burst that generates H

2

O

2

in response to a Fusarium oxysporum cell-wall

preparation. Transgenic Arabidopsis plants expressing an anti-sense cDNA encoding a type III peroxidase,
French bean peroxidase type 1 (FBP1) exhibited an impaired oxidative burst and were more susceptible than
wild-type plants to both fungal and bacterial pathogens. Transcriptional profiling and RT-PCR analysis showed
that the anti-sense (FBP1) transgenic plants had reduced levels of specific peroxidase-encoding mRNAs,
including mRNAs corresponding to Arabidopsis genes At3g49120 (AtPCb) and At3g49110 (AtPCa) that encode
two class III peroxidases with a high degree of homology to FBP1. These data indicate that peroxidases play a
significant role in generating H

2

O

2

during the Arabidopsis defense response and in conferring resistance to a

wide range of pathogens.

Keywords: apoplastic peroxidase, Arabidopsis, oxidative burst, reactive oxygen species.

Introduction

One of the earliest events in the plant-defense response
against pathogen attack is the production of reactive oxygen
species (ROS) including hydrogen peroxide and superoxide
(Bolwell and Wojtaszek, 1997; Lamb and Dixon, 1997;
Wojtaszek, 1997). Two major mechanisms have been des-
cribed for generating ROS during this so-called oxidative
burst. Depending on the host and pathogen species in-
volved, these ROS-generating mechanisms involve plasma
membrane NADPH oxidases or cell-wall peroxidases
(Bolwell et al., 1998; Grant et al., 2000a,b; Martinez et al.,
1998; Torres et al., 2002).

NADPH oxidases, also referred to as respiratory burst

oxidases, have been implicated in biotic interactions, abiotic
stress responses and development (Torres and Dangl, 2005).

In Arabidopsis thaliana, a 10-gene family of Atrboh genes
encodes homologues of the mammalian NADPH oxidase
gp91

phox

(Keller et al., 1998; Torres et al., 1998). The highly

expressed AtrbohD and AtrbohF genes are required for the
production of a full oxidative burst in response to avirulent
strains of the bacterial and oomycete pathogens Pseudo-
monas syringae and Hyaloperonospora parasitica, respect-
ively (Torres et al., 2002). Surprisingly, however, neither the
atrbohD nor atrbohF mutants, either singly or doubly, was
more susceptible to either P. syringae or H. parasitica.

In addition to NADPH oxidases, heme-containing perox-

idases are also able to generate hydrogen peroxide (Bolwell
and Wojtaszek, 1997). Unlike the NADPH oxidase reaction,
the peroxidase-mediated oxidative burst is sensitive to azide

ª 2006 The Authors

851

Journal compilation

ª 2006 Blackwell Publishing Ltd

The Plant Journal (2006) 47, 851–863

doi: 10.1111/j.1365-313X.2006.02837.x

and cyanide, but relatively insensitive to the NADPH oxidase
inhibitor diphenylene iodonium (DPI) (Bolwell et al., 1998).
Previously, we described an oxidative burst that could be
elicited in Phaseolus vulgaris (French bean) tissue culture
cells that is characterized by a cell wall-associated type III
peroxidase, French bean peroxidase type 1 (FBP1), that is
azide-sensitive but DPI-insensitive (Blee et al., 2001; Bolwell,
1999; Bolwell et al., 2002). In the experiments described
here, we have turned to Arabidopsis to elucidate further the
role of peroxidases in the pathogen-elicited oxidative burst.
Although the large size of the type III peroxidase gene family
in Arabidopsis (at least 73 type III members) and presumed
functional redundancy precluded a systematic study of
Arabidopsis peroxidase mutants, we expressed the heterol-
ogous anti-sense French bean FBP1 cDNA in transgenic
Arabidopsis plants. The FBP1 transgenic lines showed
normal morphology, but proved enormously susceptible
to spontaneous infections, with the result that we could
recover only two heterozygous lines and a homozygous line
derived from one of these. However, these lines showed an
impaired oxidative burst and enhanced susceptibility to both
bacterial and fungal pathogens.

Results

Development of an elicitor-mediated oxidative burst assay
for Arabidopsis suspension cultures

As described in detail in Experimental procedures, an oxi-
dative burst assay was developed for an Arabidopsis cell-
suspension culture treated with an elicitor derived from a
preparation of cell walls from Fusarium oxysporum. f.sp.
matthioli race 1. In contrast to a previously developed assay
for monitoring the oxidative burst in French bean cells that
utilized luminol to detect hydrogen peroxide (Bindschedler
et al., 2001), the Arabidopsis assay utilized xylenol orange.
This was necessary because the Arabidopsis suspension
cultures were green and quenched luminol fluorescence. As
shown in Figure 1(a), the F. oxysporum elicitor at
100 lg ml

)1

glucose equivalents, the optimal concentration,

induced a robust and highly reproducible oxidative burst.
Addition of catalase completely abolished the xylenol or-
ange signal, indicating it was primarily due to H

2

O

2

rather

than other reactive species (Figure 1a). The response was
elicitor-specific as the Arabidopsis cells did not respond to
Colletotrichum lindemuthianum elicitor, which was shown
previously to elicit an oxidative burst in French bean sus-
pension cultures (Bindschedler et al., 2001). The equivalence
of the luminol and xylenol orange assays was demonstrated
previously in the French bean system (Bindschedler et al.,
2001).

To distinguish whether the Arabidopsis oxidative burst is

mediated by an NADPH/NADH oxidase or a peroxidase-
dependent mechanism, inhibition studies were carried out

using diphenylene iodonium (DPI) and sodium azide. Inhi-
bition of an oxidative burst by DPI with an I

50

of approxi-

mately 0.2 l

M

is indicative of the involvement of an NADPH/

NADH oxidase, whereas inhibition by azide with an
I

50

> 50 l

M

suggests a peroxidase-dependent mechanism

(Bolwell et al., 1998; Frahry and Schopfer, 1998). Figure 1(b)
shows that sodium azide inhibited F. oxysporum-elicited
hydrogen peroxide formation in Arabidopsis tissue culture
cells with an I

50

of approximately 500 l

M

and that 2 m

M

sodium azide considerably reduced hydrogen peroxide
formation. Similar results were obtained with potassium
cyanide (not shown). The relatively high I

50

for sodium azide

Figure 1. Elicitation of an oxidative burst in Arabidopsis tissue cultures.
(a) Comparative level of the oxidative burst in Arabidopsis cell-suspension
cultures treated with 100 lg ml

)1

glucose equivalents of Fusarium oxyspo-

rum elicitor in the absence (d) or presence (s) of 10 U catalase. Also shown is
the burst in response to 25 lg ml

)1

Colletotrichum lindemuthianum elicitor

(j), the optimum for reactive oxygen species (ROS) production in French
bean cells. Production of ROS was measured by the xylenol orange assay as
described in Experimental procedures.
(b) Dose–response curve for inhibition of ROS production in F. oxysporum
elicitor-treated Arabidopsis cell-suspension cultures by sodium azide.
(c) Comparative dose–response curve for diphenylene iodonium (DPI) inhi-
bition of the oxidative burst in Arabidopsis cell-suspension cultures treated
with F. oxysporum elicitor ( ) or French bean cells treated with C. lindemu-
thianum elicitor (h) using the xylenol orange method. Values are means

 SD

from replicates from at least five independent experiments.

852 Laurence V. Bindschedler et al.

ª 2006 The Authors

Journal compilation

ª 2006 Blackwell Publishing Ltd, The Plant Journal, (2006), 47, 851–863

may be a consequence of detoxification of the inhibitor by
the suspension cells, as observed previously for bean cells
with potassium cyanide (Bolwell et al., 1998).

In contrast to sodium azide and potassium cyanide, the

Arabidopsis oxidative burst was remarkably insensitive to
DPI (Figure 1c). The insensitivity of the Arabidopsis oxida-
tive burst to DPI was significantly greater than the insensi-
tivity observed in the French bean system, where a
peroxidase was previously shown to be active: The DPI I

50

was about 2.5 l

M

for French bean, whereas in Arabidopsis

50 l

M

DPI decreased the production of hydrogen peroxide

by only 20% (Figure 1c). The reason the I

50

for DPI in French

bean observed in these experiments is lower than the
previously reported value of 25 l

M

(Bolwell et al., 1998) is

probably a consequence of the different detection systems
employed. The xylenol orange method used here directly
measures ROS concentration, whereas the luminol assay
used previously requires the activity of endogenous perox-
idases that oxidize the luminol with H

2

O

2

. Because peroxid-

ases are inhibited by DPI at higher concentrations (Frahry
and Schopfer, 1998), the luminol assay is likely to overes-
timate the I

50

of DPI. In any case, these data suggest that

peroxidases contribute to the generation of a significant
proportion of the H

2

O

2

released in the Arabidopsis oxidative

burst elicited by the Fusarium cell wall preparation.

Transgenic Arabidopsis plants expressing anti-sense FBP1
mRNA exhibit a diminished oxidative burst

A previously constructed full-length French bean cDNA
encoding FBP1 peroxidase in an anti-sense orientation (Blee
et al., 2001, 2003) was used to transform Arabidopsis eco-
type Col-0 with the expectation that the transgenic plants
might express lower levels of peroxidase(s) involved in
generating the oxidative burst (a preliminary report of this
experiment was published by Bolwell et al., 2002). Interest-
ingly, almost all of more than 20 kanamycin-resistant
transformants that were recovered succumbed to oppor-
tunistic fungal infections, and only two lines (referred to as
1.1 and 1.2) survived to maturity and set seed. Homozygous
transgenic line H

4

was derived from line 1.1 by repeated

selection of seeds on kanamycin. Despite repeated attempts,
we were not able to derive a homozygous derivative of line
1.2.

We developed a xylenol orange-based Arabidopsis leaf-

disc assay for measuring an elicitor-induced oxidative burst,
so that we could compare the oxidative burst in wild-type
and FBP1 transgenic plants (see Experimental procedures).
As shown in Figure 2(a), the two T

1

FBP1 anti-sense lines (1.1

and 1.2) exhibited significantly less F. oxysporum-elicited
release of H

2

O

2

in the surrounding medium than wild-type

Col-0 leaf disks. To confirm these results, we used an
independent method that involves 3,3

¢-diaminobenzidine

(DAB) staining of leaves (Thordal-Christensen et al., 1997)

following infection with the avirulent bacterial pathogen
Pseudomonas syringae pv. tomato DC3000 (Pto DC3000)
expressing the avirulence gene avrRpm1. Pto DC3000

(a)

(b)

(c)

Figure 2. Elicitation of reactive oxygen species (ROS) in Arabidopsis leaves.
(a) Production of ROS in leaf discs of wild-type Col-0 (d) or FBP1 transgenic
lines 1.1 (e) or 1.2 (n) treated with 25 lg ml

)1

Fusarium oxysporum elicitor.

(b) In situ detection of H

2

O

2

by 3,3

¢-diaminobenzidine (DAB) staining. Leaves of

non-transformed Col-0 plants or homozygous transgenic anti-sense FBP1 H

4

plants

were

inoculated

with

Pto

DC3000(avrRpm1)

at

OD

600

¼ 2.0

(10

7

CFU cm

)2

), detached after 2 h and infiltrated under gentle vacuum with

1 mg ml

)1

DAB containing 0.05% v/v Tween 20 and 10 m

M

sodium phosphate

buffer pH 7.0. The reaction was terminated at 6–7 h post-inoculation when a
brown precipitate began to be visible in Col-0 leaves. Leaves were examined
after bleaching by light microscopy (100

· magnification).

(c) In situ detection of H

2

O

2

by cerium chloride staining. Leaves of non-

transformed Col-0 plants or homozygous transgenic FBP1 H

4

plants were

infiltrated with Pto DC3000(avrRpm1) at 10

7

CFU cm

)2

followed by CeCl

3

staining and electron microscope detection. Scale bar, 0.5 lm. Ps, Pseudo-
monas syringae; CW, cell wall.

Peroxidase-dependent apoplastic oxidative burst 853

ª 2006 The Authors
Journal compilation

ª 2006 Blackwell Publishing Ltd, The Plant Journal, (2006), 47, 851–863

(avrRpm1) was infiltrated at the relatively high dose of
10

7

CFU cm

)2

leaf area into one half of a leaf, and infiltrated

leaves were detached 2 h later and stained with DAB for 3 h.
As shown in Figure 2(b), in wild-type Col-0 leaves a strong
precipitate appeared in the inoculated leaf halves, whereas
no precipitate was observed in the control non-inoculated
leaf halves. In comparison with Col-0 wild type, the homo-
zygous FBP1 anti-sense line H

4

showed a reduced amount of

DAB staining at both macroscopic and microscopic levels,
comparable to that reported for NADPH oxidase (Atrboh)
mutants similarly infiltrated with Pto DC3000(avrRpm1)
(Torres et al., 2002). Leaf halves that were mock-inoculated
with 10 m

M

MgSO

4

did not show any DAB staining within

the experimental time frame.

Finally, the production of hydrogen peroxide production

at the site of infection in the FBP1 anti-sense plants was
monitored using a third independent method that involves
the reaction of cerium chloride with hydrogen peroxide to
form cerium perhydroxides that are opaque in the electron
microscope. By co-infiltrating catalase, Grant et al. (2000b)
demonstrated that the electron-opaque deposits observed
after cerium chloride staining of Pto DC3000(avrRpm1)-
inoculated Arabidopsis leaves are due to reaction of
cerium chloride with hydrogen peroxide. As shown in
Figure 2(c), we observed dark cerium perhydroxides
deposits in Pto DC3000(avrRpm1)-infected Col-0 leaves at
the site of infection that were co-localized with the bacteria
at the plant cell wall. In contrast, no deposits were
observed in non-inoculated Col-0 plants (data not shown)
or in infected transgenic H

4

plants expressing anti-sense

FBP1 cDNA (Figure 2c).

Transgenic Arabidopsis expressing anti-sense FBP1 mRNA
exhibit enhanced susceptibility to both virulent and avirulent
pathogens

The observation that the primary FBP1-transformed seed-
lings frequently succumbed to spontaneous opportunistic
infections suggested that they would exhibit enhanced
susceptibility to a variety of pathogens. This was con-
firmed under controlled conditions by testing the T

1

transgenic lines 1.1 and 1.2 and the homozygous FBP1
transgenic line H

4

for susceptibility to a variety of patho-

gens. Figure 3(a) shows that the homozygous FBP1 line H

4

exhibits a significant level of enhanced susceptibility to
two unrelated virulent P. syringae strains, Pto DC3000 and
P. syringae pv. maculicola strain ES4326 (Psm ES4326).
Similar results were obtained with the T

1

transgenic lines

1.1 and 1.2, and with eight out of eight different T

2

lines

derived from T

1

line 1.1 (data not shown). Surprisingly, the

avirulent strain Psm ES4326 carrying avrRpt2 grew to at
least the same titer as the virulent strain Psm ES4326 in
FBP1 H

4

transgenic plants, suggesting that avr-gene

mediated resistance is severely compromised in the FBP1

anti-sense lines (Figure 3b). Normally, avirulent P. syringae
strains expressing avrRpt2 grow very poorly in plants such
as Col-0, which express the RPS2 resistance gene product
that corresponds to the avrRtp2 avirulence gene protein
(Figure 3b). The enhanced susceptibility of FBP1 transgenic
lines to P. syringae growth was reflected in more severe
disease symptoms when Arabidopsis leaves were infiltra-
ted either with virulent strains of Pto DC3000 or Psm
ES4326, or with isogenic avirulent strains expressing the

Figure 3. Susceptibility of FBP1 transgenic plants to bacterial and fungal
pathogens.
(a) Growth of Pto DC3000 (black bars) or Psm ES4326 (open bars) 3 days post-
inoculation of wild-type Col-0 or homozygous FBP1 transgenic H

4

leaves at a

dose of 10

4

CFU cm

)2

leaf area. Means

 SE of six determinations are shown.

(b) Growth of virulent (ES4326, black bars) or avirulent [ES4326(avrRpt2),
open bars] Psm strains 3 days post-inoculation of wild-type Col-0 or homo-
zygous FBP1 transgenic H

4

leaves with 10

3

CFU cm

)2

leaf area. Means

 SE

of eight determinations are shown. Differences between Col and H

4

were

statistically significant according to a t-test, with P

£ 0.001. The experiment

was repeated twice with similar results.
(c) Leaf pairs of Col-0 (left) and FBP1 transgenic line H

4

plants (right) either

mock-inoculated or inoculated with virulent spores of Botrytis cinerea.
(d) Opportunistic infection of FBP1 transgenic line H

4

by the powdery mildew

pathogen Golovinomyces orontii. Wild-type Col-0 and FBP1 transgenic plants
were grown side-by-side in a flat (left panel) in a glasshouse contaminated
with G. orontii spores. The FBP1 transgenic plants, but not the wild-type
plants, develop symptoms of G. orontii infection. The two right-hand panels
show close-ups of wild-type and FBP1 plants.

854 Laurence V. Bindschedler et al.

ª 2006 The Authors

Journal compilation

ª 2006 Blackwell Publishing Ltd, The Plant Journal, (2006), 47, 851–863

avirulence gene avrRpt2 (Bolwell et al., 2002; data not
shown).

The enhanced susceptibility phenotype of the transgenic

FBP1-expressing plants was also observed when challenged
with several different fungal pathogens. Figure 3(c) shows
large lesions in transgenic lines compared with relatively
small lesions in Col-0 in response to inoculation with the
necrotrophic pathogen Botrytis cinerea. Figure 3(d) shows
that FBP1 transgenic plants exhibited greatly enhanced
susceptibility to opportunistic powdery mildew infections
that were grown in the same flats side-by-side.

Arabidopsis transgenic plants expressing anti-sense FBP1
are more resistant to fumonisin FB1

Alvarez et al. (1998) demonstrated a requirement for ROS
during activation of programmed cell death (PCD) asso-
ciated with the hypersensitive response (HR). Reactive
oxygen species may also be involved in signaling that
induces PCD in response to fumonisin B1 (FB1), a phy-
totoxin produced by Fusarium moniliforme that elicits
PCD (Gilchrist, 1998). As shown in Figure 4, the FBP1 anti-
sense homozygous line H

4

was strikingly insensitive to

FB1, with greatly reduced cell death in both primary
infiltrated leaves and secondary non-infiltrated leaves.
These data suggest that peroxidases may play a signifi-
cant role in elicitation of the Arabidopsis HR.

Identification of the Arabidopsis peroxidase(s) affected by
the FBP1 anti-sense transgene

Based on the results obtained previously in French bean, the
FBP1 transgenic lines would be expected to show lowered
peroxidase specific activity in the ionically bound fraction,
which should correspond to the cell wall-bound subset of
peroxidases. Notwithstanding such a prediction, the actual
target for FBP1 transgene-mediated silencing may represent
a further sub-division of this subset of leaf peroxidases.
Figure 5(a) shows that homozygous FBP1 anti-sense line H

4

showed a significant reduction in bound peroxidase activity
to approximately 40–65% of the Col-0-specific activity. These
differences were confirmed by isoelectric profiling using
equal loading of protein fractions and staining for peroxi-
dase isoforms that gives a semi-quantitative indication of
abundance. There were no differences in the profile of sol-
uble peroxidases (data not shown), but a cationic isoform
was reduced in the bound fraction in line H

4

(Figure 5b).

To identify specifically the peroxidase(s) that are down-

regulated in the transgenic FBP-1 anti-sense lines, RNA-
expression profiles of FBP-1 transgenic plants were com-
pared with those of wild-type Col-0 using the Affymetrix full-
genome ATH1 GeneChip (Affymetrix, Santa Clara, CA, USA).
Of the 86 peroxidases (including 66 type III) annotated on the
Affymetrix ATH1 GeneChip, three were significantly down-
regulated (P

£ 0.01) in transgenic line H

4

(the entire data

set is available in Appendix S1 and at http://ausubellab.mgh.
harvard.edu/imds). However, two of the downregulated

Figure 4. Susceptibility of FBP1 transgenic lines to the fungal toxin fumon-
isin B1.
Top row, Col-0 leaf pairs (left) compared with leaf pairs of FBP1 transgenic line
H

4

(right) mock-infiltrated with 0.14% methanol or infiltrated with 10 l

M

FB1.

Bottom row, non-infiltrated leaves from plants treated with 0.14% methanol
or 10 l

M

FB1, respectively.

Figure 5. Peroxidases in leaves of FBP1 transgenic lines.
(a) Relative specific activities of peroxidases in soluble (j) and bound (h)
fractions were determined for Col-0 and FBP1 transgenic line H

4

extracts using

ABTS as substrate, as described in Experimental procedures. The experiment
was repeated three times with similar results.
(b) Isoelectric focusing profiling of bound peroxidases from Col-0 and FBP1
transgenic line H

4

. Equal amounts (20 lg) of protein were loaded per track and

the zymogram was developed using o-danisodine as described in Experi-
mental procedures.

Peroxidase-dependent apoplastic oxidative burst 855

ª 2006 The Authors
Journal compilation

ª 2006 Blackwell Publishing Ltd, The Plant Journal, (2006), 47, 851–863

peroxidase genes (At1g63460, At3g63080) are annotated
as encoding glutathione peroxidases (The Arabidopsis
Information Resource TAIR; The Institute for Genomic
Research, TIGR), which would not be expected to be present
in the cell wall-associated peroxidase fraction that has
reduced activity in the transgenic plants (Figure 5). The third
Arabidopsis peroxidase gene, At3g49120, that was identified
as downregulated by the GeneChip analysis encodes a
predicted secreted type III cationic peroxidase, and is
therefore a likely candidate for being ionically bound to
the cell wall. This peroxidase is also the most likely target
of the FBP1 anti-sense RNA, as it is the Arabidopsis
peroxidase-encoding gene with the longest region of exact
homology (25 bases) with the French bean FBP1 oxidative
burst peroxidase gene. Only four other Arabidopsis peroxi-
dases have sufficient identity with FBP1 (19–23 bases)
to enable RNAi (Semizarov et al., 2003). Of these four, no
difference in transcript level was detected by the GeneChip
analysis for three; the fourth (At3g49110), which has strong
homology to At3g49120 (75%, Vale´rio et al., 2004), is not
represented on the ATH1 array.

To confirm the reduction in At3g49120 transcript levels

and to determine whether At3g49110 is an additional target
of the anti-sense FBP1, expression levels of these two genes
in the FBP1 transgenic line H

4

and wild-type plants were

assayed by quantitative-real time RT-PCR analysis. As
shown in Figure 6(a,b), transcript levels of both At3g49110
and At3g49120 are reduced in mock-inoculated H

4

compared

with similarly treated wild-type plants. After inoculation with
Pto DC3000(avrRpm1), At3g49120 expression in H

4

is around

37% of wild type (Figure 6b). Although At3g49110 mRNA
levels do not appear to be decreased in the FBP1 anti-sense
line after inoculation (Figure 6a), this may be a consequence
of the strong upregulation of this gene in response to
infection (Figure 6c). In any case, the fact that both genes are
expressed at higher levels following inoculation (Figure 6c;
Tao et al., 2003) supports the hypothesis that these perox-
idases have a role in defense. Given the similarity in
sequence between the two peroxidases, it is likely that they
have similar activities, but as indicated by the RT-PCR assays
and proteomics data (Charmont et al., 2005, discussed
below), they are differentially regulated: At3g49120 is con-
stitutively expressed whereas At3g49110 is highly induced
on infection.

Discussion

Role of peroxidases in the Arabidopsis defense response

It is now recognized that various plants exhibit either a
plasma

membrane-localized

NADPH/NADH

oxidase-

dependent, or a cell wall peroxidase-dependent oxidative
burst, or both (for reviews see Apel and Hirt, 2004; Grant and
Loake, 2000). It is therefore important to determine in which

situations either or both enzymes are involved in the gen-
eration of ROS, and the respective roles of the two types of
ROS-generation mechanisms in the plant-defense response.
In two biochemically well characterized systems, French
bean cells and rose cells, different mechanisms are involved

Figure 6. Transcript levels

of

the

peroxidase-encoding

genes

AtPCa

(At3g49110) and AtPCb (At3g49120) in Col-0 and FBP1 transgenic line H

4

.

(a) Ratio of At3g49110 expression in H

4

versus wild-type Col-0 in plants that

were either mock-inoculated or inoculated with Pto DC3000(avrRpm1). Leaves
were harvested 5 h post-inoculation. Values are averages of three independ-
ent experiments.
(b) Ratio of At3g49120 expression in H

4

versus wild-type Col-0 in plants that

were either mock-inoculated or inoculated with Pto DC3000(avrRpm1).
(c) Change in transcript level of At3g49110 and At3g49120 in wild-type Col-0 in
response to inoculation with Pto DC3000(avrRpm1). Fold-change is relative to
mock-inoculated. Steady-state mRNA in 4-week old Col-0 and H

4

was assayed

by real-time RT-PCR and results from three independent biological replicates
were averaged.

856 Laurence V. Bindschedler et al.

ª 2006 The Authors

Journal compilation

ª 2006 Blackwell Publishing Ltd, The Plant Journal, (2006), 47, 851–863

in the generation of ROS (Bolwell et al., 1998). In French
bean, the peroxidase appears to be the dominant mechan-
ism; in rose cells, the oxidase with additional specificity to-
wards NADH as well as NADPH is dominant (Bolwell et al.,
1998). On the other hand, other plants, including cotton,
exhibit both mechanisms of ROS generation, albeit tem-
porally separated (Martinez et al., 1998).

Here we determined the extent to which cell wall-localized

peroxidases contribute to the generation of ROS in Arabid-
opsis in response to pathogens and pathogen-derived
elicitors. Using an Arabidopsis cell suspension-culture sys-
tem and an elicitor from the fungal pathogen F. oxysporum,
we showed that production of ROS is sensitive to azide and
cyanide, inhibitors that in other species have been shown to
target primarily cell wall-derived peroxidases. Consistent
with these results, the F. oxysporum-elicited production of
H

2

O

2

was relatively insensitive to DPI, an inhibitor that is

relatively specific for NADPH-oxidases. To confirm that
peroxidases play a role in the Arabidopsis oxidative burst,
we expressed a cDNA encoding the French bean peroxidase
FBP1 in the anti-sense orientation in transgenic Arabidopsis
plants. These FBP1 transgenic plants exhibited decreased
production of H

2

O

2

in response to the F. oxysporum elicitor

and to infection by an avirulent strain of P. syringae; were
more susceptible to both virulent and avirulent bacterial and
fungal pathogens; had reduced levels of ionically cell wall-
bound peroxidase activity; and exhibited lower levels of
mRNAs corresponding to two close Arabidopsis homologs
of FBP1, At3g49110 and At3g49120.

The reduced levels of the oxidative burst that we observed

in transgenic FBP1 lines, as well as their enhanced suscep-
tibility to both virulent and avirulent P. syringae strains, need
to be reconciled with previous observations that indicate that
NADPH oxidase(s) play a key role in the oxidative burst
(Grant et al., 2000b; Torres et al., 2002). In the Grant et al.
(2000b) study, H

2

O

2

production following inoculation with

Pto DC3000(avrRpm1) was sensitive to 7 l

M

DPI, and inhibi-

tion at this concentration was interpreted as demonstrating
that an NADPH oxidase was most likely the origin of ROS
detected with cerium chloride staining. Although the con-
centration of DPI used would favor inhibition of the NADPH
oxidase, the peroxidase system is also sensitive to DPI, albeit
with lower specificity, and 7 l

M

DPI would also inhibit

peroxidase-generated ROS to some extent (Frahry and
Schopfer, 1998). In another study utilizing a ROS-responsive
GST-luciferase gene expression system, the oxidative burst
proved to be sensitive to both 3 l

M

DPI and 1 l

M

azide when

the inhibitor was co-inoculated with either avrB- or avrRpt2-
expressing P. syringae strains (Grant et al., 2000a). This was
interpreted as indicating that both oxidases and peroxidases
could be engaged in generating ROS in Arabidopsis.

By generating a series of Arabidopsis NADPH oxidase

mutants, Torres et al. (2002) showed that the AtrbohD and
AtrbohF genes were required for production of a full

oxidative burst. Because our results show that peroxidases
are also required for H

2

O

2

production in response to the

same avirulent P. syringae strains, it seems likely that both
membrane-associated NADPH oxidases and cell wall-bound
peroxidases are required to generate H

2

O

2

. A major differ-

ence in our study, in comparison with the Torres et al. (2002)
study, is that we observed that the FBP1 anti-sense trans-
genic plants are highly susceptible to pathogen infection,
whereas the atrboh mutants in the Torres et al. (2002) study
were not more susceptible. This raises a question as to the
respective roles of peroxidases and oxidases in the oxidative
burst.

A possible explanation of the role of peroxidases in the

oxidative burst comes from recent work of Torres et al.
(2005), in which they constructed an lsd1 atrbohD atrbohF
triple mutant. The lsd1 (lesions simulating disease) mutant
exhibits spreading lesions and, surprisingly, the triple
mutant exhibited an enhanced spreading lesion phenotype
compared with lsd1, contrary to what was expected if the
NADPH oxidase-generated burst was responsible for trig-
gering cell death. Torres et al. (2005) concluded, counter-
intuitively, that the role of NADPH oxidases is to limit the
spread of a salicylic acid-elicited cell-death program in cells
surrounding an infection site. Moreover, they showed that
the NADPH oxidases need to be activated by an independent
source of ROS to generate their own oxidative burst.

A model, consistent with our observations as well as

those of Torres et al. (2005), is that apoplastic peroxidases
are an initial rapid source of ROS, and are essential for
conferring at least partial resistance independently of any
involvement of NADPH oxidases. Subsequently, the peroxi-
dase-generated ROS activate NADPH oxidases, which, in
turn, generate a plasma membrane-associated oxidative
burst, the primary role of which is to limit the extent of cell
death in neighboring cells. If this model is correct, the failure
to detect an oxidative burst in Arabidopsis atrbohD/F
mutants could be a consequence of the fact that the
oxidative burst assays were carried out several hours after
elicitation, long after a peroxidase-mediated burst may have
occurred (Torres et al., 2002, 2005).

For some species, there is evidence that recognition of

virulent and avirulent pathogens produces different oxida-
tive burst profiles, with early ROS production observed in
non-host, compatible and incompatible interactions, and a
later, more extensive and sustained burst only in R gene-
mediated resistance responses (Apel and Hirt, 2004; Grant
and Loake, 2000). Data presented here support a role for cell
wall-associated peroxidase(s) in both phases, as hydrogen
peroxide production is reduced in the FBP1 transgenic line
compared with wild-type plants following elicitation with an
elicitor from cell walls of F. oxysporum within a 1-h time
frame, or elicitation with an avirulent strain of bacteria
within a 5-h time frame. One possibility is that peroxidase(s)
catalyze ROS production during basal resistance triggered

Peroxidase-dependent apoplastic oxidative burst 857

ª 2006 The Authors
Journal compilation

ª 2006 Blackwell Publishing Ltd, The Plant Journal, (2006), 47, 851–863

by recognition of pathogen-associated molecular patterns of
virulent pathogens, and that this initial oxidative burst is
essential for subsequent activation of NADPH oxidase
during an R gene-mediated HR, as well as for activation of
basal defenses. In this model, peroxidases play an essential
role in basal resistance, independently of their role in
activating NADPH oxidases, explaining why the FBP1 anti-
sense line has a much more severe phenotype than an
atrbohD/F mutant. Consistent with this interpretation is our
observation that the FBP1 transgenic plants are more
susceptible to highly virulent necrotrophic (B. cinerea) and
biotrophic (powdery mildew, Golovinomyces orontii) fungal
pathogens as well as virulent and avirulent P. syringae
strains. Additional support for this model comes from recent
work showing differential effects of DPI on H

2

O

2

production

following challenge of Arabidopsis leaves with hrpL mutants
of P. syringae pv. phaseolicola, or with P. syringae pv.
phaseolicola carrying an avirulence gene that triggers an HR.
Interestingly, the oxidative burst elicited by the hrpL mutant,
which induced papilla formation but not HR, was much less
susceptible to DPI inhibition than the burst elicited by the avr
gene, suggesting that ROS may be generated by different
mechanisms, depending on the challenge (Soylu et al.,
2005). Alternatively, overexpressing FBP1 might compro-
mise resistance by preventing oxidative cell-wall cross-
linking and the formation of barriers. However, the loss of
resistance to avirulent P. syringae argues against an effect
solely on physical barriers. Distinguishing between these
possibilities requires further biochemical studies, such as
those carried out in French bean (Bolwell et al., 2002), and
assays of defense gene expression. Insertion mutants that
target specifically either At3g49120 or At3g49110 would help
clarify the involvement of these two peroxidases during
defense. However, lines with insertions in regions of
At3g49120 that would be likely to interfere with protein
function are not available: although Arabidopsis stock
collections list such mutants, it is not possible to obtain
them; in at least one case the line could not be maintained,
consistent with our own experience. It is likely that tests of
the requirement of AtPCb and/or AtPCa for the production of
H

2

O

2

in response to potential pathogens will require an

inducible system for targeted reduction of At3g49110 and
At3g49120 expression.

Arabidopsis peroxidases

Although the cationic French bean FBP1 peroxidase shows
reasonable similarity to a number of Arabidopsis type III
peroxidases, including the anionic AtPA2, which has a
putative role in lignification (Ostergaard et al., 2000),
expression of anti-sense cDNA coding for FBP1 appears to
target specifically At3g49120 and At3g49110 that encode
AtPCb and AtPCa, respectively (Vale´rio et al., 2004). Both
peroxidases have been grouped by a detailed phylogenetic

analysis in a clade of seven out of the 73 type III peroxidases
in the Arabidopsis genome that is closest to FBP1 (Duroux
and Welinder, 2003). Comparison of FBP1 and AtPCb amino
acid sequences indicates that they share 53.1% identity and
65.4% similarity, while FBP1 and AtPCa have 53.3% identity
and 65.0% similarity. Furthermore, FBP1, AtPCa and AtPCb
are all cationic, have a similar number of potential glycosy-
lation sites, and have an unusual carboxy-terminal exten-
sion that is known to be cleaved in the case of FBP1 (Blee
et al., 2001). All three have predicted amino-terminal secre-
tion sequences leading to cell-wall localization. These
properties of AtPCa and AtPCb are consistent with the data
in Figure 5 that show a reduction of a wall-bound cationic
peroxidase activity in the FBP1 transgenic plants. AtPCb and
AtPCa have been characterized previously (Ostergaard et al.,
1998; Tognolli et al., 2002; Welinder et al., 2002). AtPCb is
expressed throughout the plant, whereas AtPCa has been
detected only in aerial organs (Welinder et al., 2002). Like
FBP1, AtPCb is induced in response to a variety of different
pathogens and elicitors including virulent and avirulent H.
parasitica, avirulent Pto DC3000, B. cinerea, and oligoga-
lacturonides (Maleck et al., 2000; Scheideler et al., 2002; Tao
et al., 2003; S. Ferrari, J.P., C.D., J.D. and F.M.A., unpub-
lished data). Less is known about the regulation of AtPCa
because it is not represented on the Affymetrix ATH1
GeneChip, although the data in Figure 6 show that it is
strongly induced following P. syringae infection. At the
protein level, AtPCb is one of only eight extracellular per-
oxidases detected in the culture medium of liquid-grown 2-
week-old seedlings; AtPCa was not detected (Charmont
et al., 2005). Data from the FBP1 anti-sense transgenic line
do not allow us to determine the relative importance of
AtPCb and AtPCa in limiting pathogen growth, as both per-
oxidases have reduced expression in this line. However, the
difference in protein levels prior to infection, and the diffi-
culty of maintaining lines with insertions in At2g49120,
suggest that, of the two, AtPCb has the more critical role in
defense.

Interestingly, two glutathione peroxidases were also

downregulated in uninfected leaves of the FBP1 anti-sense
plants. Presumably, these would function in scavenging
ROS. It may well be that levels of ROS accumulating over
time in these plants under normal light conditions are
reduced compared with the wild type, resulting in lower
levels of induction of protective peroxidases. It is unlikely
that these two glutathione peroxidases are direct targets of
the FBP1 anti-sense transgene, as they have both low overall
similarity and regions of identity with FBP1 that are no
longer than 10 nucleotides.

Susceptibility of transgenic FBP1 plants to pathogens

Despite all efforts, most of the Arabidopsis transgenic FBP1
lines succumbed to opportunistic fungal infections during

858 Laurence V. Bindschedler et al.

ª 2006 The Authors

Journal compilation

ª 2006 Blackwell Publishing Ltd, The Plant Journal, (2006), 47, 851–863

culturing. However, two T

1

lines survived and homozygous

lines were derived from one of these. The plants that sur-
vived were normal phenotypically, although the homozy-
gous lines formed somewhat larger rosette leaves and
inflorescence initiation was delayed compared with Col-0.
However, because of their susceptibility to opportunistic
infections, even these surviving FBP1 transgenic lines are
very difficult to maintain. The FBP1 transgenic lines dem-
onstrated reduced capacity for ROS generation when chal-
lenged with the F. oxysporum elicitor in the leaf-disc assay,
and exhibited a level of disease susceptibility comparable
with previously isolated Arabidopsis enhanced disease
susceptibility (eds) mutants including npr1 and pad4
(Glazebrook et al., 1996; Rogers and Ausubel, 1997) when
challenged with the virulent bacterial pathogens Psm
ES4326 or Pto DC3000.

In contrast to most other eds mutants, however, the

transgenic FBP1 plants exhibited enhanced susceptibility
to avirulent P. syringae strains. While Psm ES4326(av-
rRpt2) grew less than 10-fold in wild-type Col-0 plants over
3 days, the same strain multiplied 20 000-fold in line H

4

and actually exceeded growth of a near-isogenic virulent
strain of Psm by a small but reproducible amount. A
number of studies have demonstrated that, in the absence
of an R gene-mediated resistance response, bacterial
avirulence proteins (including AvrRpt2) have effector or
virulence functions (Abramovitch et al., 2003; Chen et al.,
2004; Chisholm et al., 2005; Greenberg and Vinatzer, 2003;
Hauck et al., 2003; Kim et al., 2005; Metz et al., 2005). Our
data suggest that not only basal resistance, but also R
gene-mediated resistance, are compromised by a reduc-
tion in AtPCb and/or AtPCa activity. Consistent with an
increase in bacterial growth, tissue collapse 3 days after
inoculation with either virulent or avirulent P. syringae
strains was more extensive in the peroxidase anti-sense
lines than in the wild type.

The peroxidase anti-sense lines are also unusual in

having increased susceptibility to a broad range of virulent
pathogens. Many of the mutants isolated on the basis of
enhanced susceptibility to P. syringae do not show a
similar eds phenotype with G. orontii or B. cinerea (Ferrari
et al., 2003; Reuber et al., 1998) and, conversely, a majority
of mutants isolated in a screen for enhanced susceptibility
to G. orontii are not significantly more susceptible to
P. syringae ES4326 (Dewdney et al., 2000). However, FBP1
anti-sense line H

4

is strikingly more susceptible than the

wild-type to all three of these pathogens, which represent
bacterial, biotrophic fungal and necrotrophic fungal phy-
topathogens.

Although FBP1 anti-sense plants exhibited increased

susceptibility to pathogens, they were more resistant to
the fungal toxin fumonisin B1. In wild-type plants, fumonisin
B1 triggers the generation of reactive oxygen intermediates
(Stone et al., 2000), which may be essential for FB1 induction

of HR-like cell death (Gilchrist, 1998). A number of studies
(Alvarez et al., 1998; Bennett et al., 2005; Delledonne, 2005;
Kliebenstein et al., 1999; Mach et al., 2001; Torres et al.,
2005) indicate that cell-death programs are impacted by
multiple ROS, including superoxide, hydrogen peroxide and
nitric oxide, which may activate or repress cellular suicide.
Although the precise mechanism of FB1-induced cell death
in Arabidopsis is unclear, the attenuation of HR-like cell
death in FB1-treated FBP1 anti-sense plants suggests that
peroxidase-generated H

2

O

2

is involved. It would be of

interest to test whether the atrbohD/F double mutant is also
resistant to fumonisin B1.

Experimental procedures

Plant material

Arabidopsis thaliana ecotype Columbia (Col-0) plants were germi-
nated and grown in a glasshouse or climate-controlled chamber as
described by Reuber et al. (1998). Arabidopsis suspension-culture
cell lines were a kind gift of Professor A. R. Slabas, Durham Uni-
versity, UK, and were maintained in Murashige and Skoog basal
salts with minimal organics (MSMO) medium (Sigma, Poole, Dor-
set, UK) containing sucrose (30 g l

)1

), naphthylene acetic acid

(0.5 mg l

)1

) and kinetin (0.05 mg l

)1

) under low light intensity in a

16 h light/8 h dark regime.

Bacterial strains and growth conditions

The virulent bacterial strains Pseudomonas syringae pv. maculicola
ES4326 (Dong et al., 1991) and P. syringae pv. tomato DC3000
(Cuppels, 1986) have been described previously. The corresponding
isogenic avirulent strains carry avrRpt2 on the plasmid pLH12
(Whalen et al., 1991) or avrRPM1 on plasmid pVSP61 (Debener
et al., 1991). Pseudomonas syringae strains were grown at 28

C in

King’s B medium (10 mg ml

)1

protease peptone, 2 mg ml

)1

K

2

HPO

4

, 10 mg ml

)1

glycerol, 6 m

M

MgSO

4

pH 7.0) supplemented

with 100 lg ml

)1

streptomycin for strain ES4326 or 25 lg ml

)1

rif-

ampicin for strains DC3000. Strains containing pLH12 and pVSP61
were maintained on media containing 10 lg ml

)1

tetracycline or

25 lg ml

)1

kanamycin, respectively.

Fungal strains, toxins and elicitor preparation

Golovinomyces orontii (formerly Erysiphe orontii) isolate MGH
(Plotnikova et al., 1998), Botrytis cinerea (Ferrari et al., 2003) and
Fusarium oxysporum f.sp. matthioli race 1 (Kistler et al., 1991) have
been described previously. An F. oxysporum elicitor preparation
was prepared by culturing F. oxysporum as a yeast form in half-
strength potato dextrose broth (Sigma P-6685), collecting yeast cells
by centrifugation, resuspending in 100 ml 500 m

M

KH

2

PO

4

, and

centrifuging at 5000 g in an SS-34 rotor (Sorvall, Asheville, NC,
USA) for 30 min. The pellet was resuspended in 200 ml 50 m

M

KH

2

PO

4

and centrifuged as above. The pellet was then sequentially

washed and centrifuged in chloroform:methanol (1:1 v/v) and
acetone. The pellet was resuspended in ddH

2

O (10 g pellet l

)1

) and

autoclaved for 30 min at 121

C. The elicitor preparation was stored

at

)20C until use. Fumonisin B1 was obtained from Sigma and kept

as a stock solution of 7 m

M

in methanol.

Peroxidase-dependent apoplastic oxidative burst 859

ª 2006 The Authors
Journal compilation

ª 2006 Blackwell Publishing Ltd, The Plant Journal, (2006), 47, 851–863

Transformation of Arabidopsis

The isolation of a French bean oxidative burst peroxidase cDNA
(FBP1 cDNA) has been described (Blee et al., 2001). Agrobacterium
tumefaciens strain LB4044, harboring the binary vector pBin19
expressing FBP1 in the anti-sense direction under the control of the
CaMV/35S promoter and the A. tumefaciens nopaline synthase
terminator (Blee et al., 2003), was used to transform Col-0 plants as
described (Clough and Bent, 1998). Transformed plants were placed
in the dark with high humidity overnight, then returned to the
glasshouse to allow seed setting. Putative transgenic seeds were
collected, surface sterilized, resuspended in 0.1% agar, germinated
on solid MS salts medium (0.8% phytoagar) containing 50 lg ml

)1

kanamycin, transferred to soil, and screened for the presence of the
transgene using the PCR as follows. DNA was isolated from leaf
tissue using the fast DNA kit for plants (Bio 101, Carlsbad, CA, USA)
and added to Ready to Go PCR beads (Amersham Pharmacia Bio-
tech, Buckinghamshire, UK) with CaMV/35S promoter and nopaline
synthase terminator primers 5

¢-CAATCCCACTATCCTTCGC-3¢ and

5

¢-CATCGCAAGACCGGCAACAG-3¢,

respectively.

Cycling

pro-

ceeded after 7 min at 95

C with 40 cycles of 1 min at 95C, 1 min at

58

C and 2 min at 72C. T

n

lines were derived by repeated selection

on 50 lg ml

)1

kanamycin leading to homozygous lines as deter-

mined by PCR analysis of T

3

progeny.

Elicitation of suspension cultured cells and leaf discs:
measurement of the oxidative burst

Suspension-cultured cells and leaf discs (0.13 cm

2

) were treated

directly with the F. oxysporum elicitor preparation at a concentra-
tion of 25 lg ml

)1

glucose equivalents. In the case of leaf discs, 30

discs excised using a cork borer were floated on 2 ml H

2

O con-

taining elicitor in Petri dishes (90-mm diameter), vacuum-infiltrated
three times for 10 sec each time, and gently swirled on a platform
shaker. For both the suspension-cell and leaf-disc assays, 150 ll
medium was withdrawn at various times, briefly centrifuged, and
the amount of H

2

O

2

in 100 ll was measured using xylenol orange,

as described (Bindschedler et al., 2001).

Pathogen-susceptibility assays

For bacterial growth assays, plants grown in a climate-controlled
chamber were infiltrated with the relevant bacteria at the doses
indicated. Dose was determined by OD

600

, with approximately

10

3

CFU cm

)2

leaf area being equivalent to an OD

600

of 0.0002.

Bacterial growth was assayed by excising a leaf sample consisting
of one or two 0.13-cm

2

disks from each infected leaf using a cork

borer and grinding the sample in a microfuge tube in 200 ll 10 m

M

MgSO

4

using a plastic pestle. Appropriate dilutions were plated on

King’s B medium containing the appropriate antibiotic(s). Growth
data are reported as the log of the bacterial CFU cm

)2

leaf area (log

CFU cm

)2

). For B. cinerea susceptibility assays, leaves of 4-week-old

plants were inoculated with 5 ll drops of a 5

· 10

5

spore suspension

and scored 4 days post-inoculation. Golovinomyces orontii infec-
tion occurred opportunistically.

Detection of reactive oxygen species

For in situ detection of H

2

O

2

, DAB staining was carried out using an

adaptation of the method of Thordal-Christensen et al. (1997).
Bacteria were inoculated at OD

600

¼ 2.0 (10

7

CFU cm

)2

) into leaves,

which were collected after 2 h and infiltrated under gentle vacuum

with 1 mg ml

)1

DAB containing 0.05% v/v Tween 20 and 10 m

M

sodium phosphate buffer pH 7.0. The reaction was terminated at 6–
7 h post-inoculation, when a brown precipitate started to be visible
in Col-0 leaves. Leaves were fixed and then boiled for 15 min in
ethanol:acetic acid:glycerol 3:1:1. Bleaching solution was replaced
and leaves were incubated until the chlorophyll was completely
bleached. Leaves were observed by light microscopy under bright
field at 100

· magnification. Hydrogen peroxide was also detected in

situ by electron microscopy with cerium chloride staining. Leaves
were inoculated as described above; after 3 h, 1–2-mm

2

pieces were

incubated for 1 h in CeCl

3

. Leaf tissue was dehydrated and fixed as

described by Bestwick et al. (1997). Samples were observed at
20 000- or 30 000-fold magnification using a Hitachi H600 trans-
mission electron microscope.

Peroxidase assays

Peroxidases were extracted from leaves by grinding in 100 m

M

Tris–

HCl buffer pH 7.2 containing 5 m

M

2-mercaptoethanol and 0.25

M

sucrose. Homogenates were centrifuged at 14 000 g for 5 min and
the supernatant collected as the soluble fraction. The pellet was
resuspended in 20 m

M

Tris–HCl pH 7.2, 1

M

NaCl, 1 m

M

CaCl

2

, 1 m

M

MgCl

2

, 1 m

M

MnCl

2

, and extracted end-over-end for 30 min at 4

C.

Following centrifugation at 14 000 g for 5 min, the supernatants
were pooled and referred to as the ‘ionically-bound’ peroxidase
fraction. Peroxidase activity was determined spectrophotometri-
cally at 405 nm using 10 m

M

2,2

¢-azino-bis(3-ethylbenzothiazoline-

6-sulfonic acid) diammonium salt (ABTS) as substrate in 1 ml
10 m

M

sodium acetate buffer pH 4.4 and 0.1 m

M

H

2

O

2

to which 50 ll

enzyme extract was added to start the reaction. Peroxidase fractions
were also separated by isoelectric focusing (IEF). Equal amounts
(20 lg) of protein were applied to precast IEF gels (pH range 3–10;
Pharmacia, Sandwich, Kent, UK) and proteins separated using 0.4%
(w/v) arginine and lysine, respectively, in 12% aqueous ethylene
diamine as cathiodic buffer and 0.33% (w/v) aspartic acid and 0.37%
(w/v) glutamic acid as aniodic buffers. Electrophoresis was per-
formed at 6 W for 3 h. Plates were developed using 0.04% o-dani-
sidine and 0.15% H

2

O

2

in 10 m

M

sodium acetate buffer pH 4.5.

Genome-wide expression profiling

Two samples of Col-0 or FBP1 transgenic H

4

plants, each sample

consisting of leaves from six plants, were harvested from 4-week-
old uninfected plants. Total RNA was extracted using the Qiagen
RNeasy Plant RNA Miniprep kit (Qiagen, Valencia, CA, USA). Each
sample was split into two before homogenization and re-pooled
before loading on the RNA-binding column. RNA quality was as-
sessed by determining the A

260/280

ratio of RNA in Tris buffer and by

checking the integrity of RNA on an Agilent 2100 Bioanalyser (Agi-
lent Technologies, Palo Alto, CA, USA). Target labeling and
hybridization to Affymetrix ATH1 GeneChips were performed
according to the protocol given in the Affymetrix GeneChip
Expression Analysis Technical Manual 701025, rev. 1 (for details see
Appendix S1). Arrays were scanned using an Affymetrix GeneArray
2500 Scanner and Affymetrix

MICROARRAY SUITE

ver. 5.0 software.

Data analysis was performed with

ROSETTA RESOLVER

ver. 3.2

GENE

EXPRESSION DATA ANALYSIS SYSTEM

(Rosetta Inpharmatics, Kirkland,

WA, USA), using Affymetrix CEL files of array feature intensities and
standard deviations as input. Determination of absolute intensity
values, propagation of error and P values, and normalization for
comparing arrays in the

RESOLVER

system have been described by

Waring et al. (2001). To increase detection sensitivity, data from the
two replicate samples of each line were combined after global

860 Laurence V. Bindschedler et al.

ª 2006 The Authors

Journal compilation

ª 2006 Blackwell Publishing Ltd, The Plant Journal, (2006), 47, 851–863

normalization, and average intensity, error and P value were derived
for each gene. For comparison of H

4

with wild type, ratios of average

normalized intensities were log

10

-transformed and P values of dif-

ferential expression were determined by t-test. For gene annotation
we used the TAIR and TIGR databases.

Real-time RT-PCR

RNA, isolated as described for expression profiling, was reverse-
transcribed with iScript Reverse Transcriptase (Bio-Rad, Hercules,
CA, USA) using the manufacturer’s protocol. At3g49120 and
At3g49110 cDNAs were amplified using iQ SYBR green Supermix
(Bio-Rad) with primers TATGCTCACCATTGCAGCTC and GGACG-
ATCGAGACCAACATT for At3g49120 and primers TGTCCTCGC-
AATGGTAATCA and GATTGTGTCAGTGGCATTGG for At3g49110.
The amplification protocol included an initial 3

¢ incubation at 95

followed by 45 cycles of 95

10¢, 5530¢, and 7230¢. Ubiquitin

(At5g25760) was used as a standard, and amplified using primers
TTACGAAGGCGGTGTTTTTCAG and TTCCCTGAGTCGCAGTTAA-
GAG. Relative levels of transcripts were calculated using the
method of Pfaffl (2001).

Acknowledgements

We thank the Harvard University Bauer Center for Genomics Re-
search, especially J. Couget, P. Grosu, R. Gali and C. Bailey, for
assistance with microarray analysis of expression profiles. We also
thank M. Torres for helpful comments on the manuscript. This work
was funded by NIH Grant R37 GM48707 and NSF 2010 Grant DBI-
0114783 awarded to F.M.A.

Supplementary Material

The following supplementary material is available for this article
online:

Appendix S1. Microarray hybridization.
This material is available as part of the online article from http://

www.blackwell-synergy.com

References

Abramovitch, R.B., Kim, Y.J., Chen, S., Dickman, M.B. and Martin,

G.B. (2003) Pseudomonas type III effector AvrPtoB induces plant
disease susceptibility by inhibition of host programmed cell
death. EMBO J. 22, 60–69.

Alvarez, M.E., Pennell, R.I., Meijer, P.-J., Ishikawa, A., Dixon, R.A.

and Lamb, C. (1998) Reactive oxygen intermediates mediate a
systemic signal network in the establishment of plant immunity.
Cell, 93, 773–784.

Apel, K. and Hirt, H. (2004) reactive oxygen species: metabolism,

oxidative stress, and signal transduction. Annu. Rev. Plant Biol.
55, 373–399.

Bennett, M., Mehta, M. and Grant, M. (2005) Biophoton imaging; a

non-destructive method for assaying R gene responses. Mol.
Plant Microb. Interact. 18, 95–102.

Bestwick, C.S., Brown, I.R., Bennett, M.H.R. and Mansfield, J.W.

(1997) Localisation of hydrogen peroxide accumulation during
the hypersensitive reaction of lettuce cells to Pseudomonas syr-
ingae pv. phaseolicola. Plant Cell, 9, 209–221.

Bindschedler, L.V., Minibayeva, F., Gardber, S.L., Gerrish, C.,

Davies, D.R. and Bolwell, G.P. (2001) Early signalling events in the

apoplastic oxidative burst in suspension cultured French bean
cells involve cAMP and Ca

2

þ

. New Phytol. 151, 185–194.

Blee, K. A., Jupe, S.C., Richard, G., Zimmerlin, A., Davies, D.R. and

Bolwell, G.P. (2001) Molecular identification and expression of
the peroxidase responsible for the oxidative burst in French bean
(Phaseolus vulgaris L.) and related members of the gene family.
Plant Mol. Biol. 47, 607–620.

Blee, K.A., Choi, J.-W., O’Connell, A.P., Schuch, W., Lewis, N.G. and

Bolwell, G.P. (2003) A lignin-specific peroxidase in tobacco whose
antisense suppression leads to vascular tissue modification.
Phytochemistry, 64, 163–176.

Bolwell, G.P. (1999) Role of active oxygen species and NO in plant

defence responses. Curr. Opin. Plant Biol. 2, 287–294.

Bolwell, G.P. and Wojtaszek, P. (1997) Mechanisms for the gen-

eration of reactive oxygen species in plant defence – a broad
perspective. Physiol. Mol. Plant Pathol. 51, 347–366.

Bolwell, G.P., Davies, D.R., Gerrish, C., Auh, C.K. and Murphy, T.M.

(1998) Comparative biochemistry of the oxidative burst produced
by rose and French bean cells reveals two distinct mechanisms.
Plant Physiol. 116, 1379–1385.

Bolwell, G.P., Bindschedler, L.V., Blee, K.A., Butt, V.S., Davies, D.R.,

Gardner, S.L., Gerrish, C. and Minibayeva, F. (2002) The apo-
plastic oxidative burst in response to biotic stress in plants: a
three component system. J. Exp. Bot. 53, 1367–1376.

Charmont, S., Jamet, E., Pont-Lezica, R. and Canut, H. (2005) Pro-

teomic analysis of secreted proteins from Arabidopsis thaliana
seedlings: improved recovery following removal of phenolic
compounds. Phytochemistry, 66, 453–461.

Chen, Z., Kloek, A.P., Cuzick, A., Moeder, W., Tang, D., Innes, R.W.,

Klessig, D.F., McDowell, J.M. and Kunkel, B.N. (2004) The Pseu-
domonas syringae type III effector AvrRpt2 functions down-
stream or independently of SA to promote virulence on
Arabidopsis thaliana. Plant J. 37, 494–504.

Chisholm, S.T., Dahlbeck, D., Krishnamurthy, N., Day, B., Sjolander,

K. and Staskawicz, B.J. (2005) Molecular characterization of
proteolytic cleavage sites of the Pseudomonas syringae effector
AvrRpt2. Proc. Natl Acad. Sci. USA, 102, 2087–2092.

Clough, S.J. and Bent, A.F. (1998) Floral dip: a simplified method for

Agrobacterium-mediated transformation of Arabidopsis thaliana.
Plant J. 16, 735–743.

Cuppels, D.A. (1986) Generation and characterisation of Tn5 inser-

tion mutations in Pseudomonas syringae pv. tomato. Appl.
Environ. Microbiol. 52, 323–327.

Debener, T., Lehnackers, H., Arnold, M. and Dangl, J.L. (1991)

Identification and molecular mapping of a single Arabidopsis
thaliana locus determining resistance to a phytopathogenic
Pseudomonas syringae isolate. Plant J. 1, 289–302.

Delledonne, M. (2005) NO news is good news for plants. Curr. Opin.

Plant Biol. 8, 390–396.

Dewdney, J., Reuber, T.L., Wildermuth, M.C., Devoto, A., Cui, J.,

Stutius, L.M., Drummond, E.P. and Ausubel, F.M. (2000) Three
unique mutants of Arabidopsis identify eds loci required for lim-
iting growth of a biotrophic fungal pathogen. Plant J. 24, 205–218.

Dong, X., Mindrinos, M., Davis, K.R. and Ausubel, F.M. (1991)

Induction of Arabidopsis defense genes by virulent and avirulent
Pseudomonas syringae strains and by a cloned avirulence gene.
Plant Cell, 3, 61–72.

Duroux, L. and Welinder, K.G. (2003) The peroxidase gene family in

plants: a phylogenetic overview. J. Mol. Evol. 57, 397–407.

Ferrari, S., Plotnikova, J.M., De Lorenzo, G. and Ausubel, F.M. (2003)

Arabidopsis local resistance to Botrytis cinerea involves salicylic
acid and camalexin and requires EDS4 and PAD2, but not SID2,
EDS5 or PAD4. Plant J. 35, 193–205.

Peroxidase-dependent apoplastic oxidative burst 861

ª 2006 The Authors
Journal compilation

ª 2006 Blackwell Publishing Ltd, The Plant Journal, (2006), 47, 851–863

Frahry, G. and Schopfer, P. (1998) Inhibition of O

2

-reducing activity

of horseradish peroxidase by diphenyleneiodonium. Phyto-
chemistry, 48, 223–227.

Gilchrist, D.G. (1998) Programmed cell death in plant disease: the

purpose and promise of cellular suicide. Annu. Rev. Phytopathol.
36, 393–414.

Glazebrook, J., Rogers, E.E. and Ausubel, F.M. (1996) Isolation of

Arabidopsis mutants with enhanced disease susceptibility by di-
rect screening. Genetics, 143, 973–982.

Grant, J.J. and Loake, G.J. (2000) Role of reactive oxygen interme-

diates and cognate redox signaling in disease resistance. Plant
Physiol. 124, 21–29.

Grant, J.J., Yun, B.-W. and Loake, G.J. (2000a) Oxidative burst and

cognate redox signalling reported by luciferase imaging: identi-
fication of a signal network that functions independently of
ethylene, SA and Me-JA but is dependent on MAPKK activity.
Plant J. 24, 569–582.

Grant, M., Brown, I., Adams, S., Knight, M., Ainslie, A. and Mans-

field, J. (2000b) The RPM1 plant disease resistance gene facili-
tates a rapid and sustained increase in cytosolic calcium that is
necessary for the oxidative burst and hypersensitive cell death.
Plant J. 23, 441–450.

Greenberg, J.T. and Vinatzer, B.A. (2003) Identifying type III effec-

tors of plant pathogens and analyzing their interaction with plant
cells. Curr. Opin. Microbiol. 6, 20–28.

Hauck, P., Thilmony, R. and He, S.Y. (2003) A Pseudomonas syrin-

gae type III effector suppresses cell wall-based extracellular def-
ense in susceptible Arabidopsis plants. Proc. Natl Acad. Sci. USA,
100, 8577–8582.

Keller, T., Damude, H.G., Werner, D., Doerner, P., Dixon, R.A. and

Lamb, C. (1998) A plant homolog of the neutrophil NADPH oxid-
ase gp91

phox

subunit encodes a plasma membrane protein with

Ca

2

þ

binding motifs. Plant Cell, 10, 255–266.

Kim, M.G., da Cunha, L., McFall, A.J., Belkhadir, Y., Debroy, S.,

Dangl, J.L. and Mackey, D. (2005) Two Pseudomonas syringae
type III effectors Inhibit RIN4-regulated basal defense in Arabid-
opsis. Cell, 121, 749–759.

Kistler, H.C., Momol, E.A. and Benny, U. (1991) Repetitive genomic

sequences for determining relatedness among strains of Fusa-
rium–Oxysporum. Phytopathology, 81, 331–336.

Kliebenstein, D.J., Dietrich, R.A., Martin, A.C., Last, R.L. and Dangl,

J.L. (1999) LSD1 regulates salicylic acid induction of copper zinc
superoxide dismutase in Arabidopsis thaliana. Mol. Plant Mi-
crobe Interact. 12, 1022–1026.

Lamb, C. and Dixon, R.A. (1997) The oxidative burst in plant disease

resistance. Annu. Rev. Plant Physiol. Plant Mol. Biol. 48, 251–275.

Mach, J.M., Castillo, A.R., Hoogstraten, R. and Greenberg, J.T.

(2001) The Arabidopsis-accelerated cell death gene ACD2 en-
codes red chlorophyll catabolite reductase and suppresses the
spread of disease symptoms. Proc. Natl Acad. Sci. USA, 98, 771–
776.

Maleck, K., Levine, A., Eulgem, T., Morgan, A., Schmid, J., Lawton,

K.A., Dangl, J.L. and Dietrich, R.A. (2000) The transcriptome of
Arabidopsis thaliana during systemic acquired resistance. Nat.
Genet. 26, 403–410.

Martinez, C., Montillet, J.L., Bresson, E., Agnel, J.P., Daı¨, G.H.,

Daniel, J.F., Geiger, J.P. and Nicole, M. (1998) Apoplastic per-
oxidase generates superoxide anions in cells of cotton cotyledons
undergoing the hypersensitive reaction to Xanthomonas cam-
pestris pv. malvacearum race 18. Mol. Plant Microbe Interact. 11,
1038–1047.

Metz, M., Dahlbeck, D., Morales, C.Q., Al Sady, B., Clark, E.T. and

Staskawicz, B.J. (2005) The conserved Xanthomonas campestris
pv. vesicatoria effector protein XopX is a virulence factor and

suppresses host defense in Nicotiana benthamiana. Plant J. 41,
801–814.

Ostergaard, L., Pedersen, A.G., Jespersen, H.M., Brunak, S. and

Welinder, K.G. (1998) Computational analyses and annotations of
the Arabidopsis peroxidase gene family. FEBS Lett. 433, 98–102.

Ostergaard, L., Teilum, K., Mirza, O., Petersen, M., Welinder, K.G.,

Mundy, J., Gajhede, M. and Hendriksen, A. (2000) Arabidopsis
ATPA2 peroxidase: expression and high-resolution structure of a
plant peroxidase with implications for lignification. Plant Mol.
Biol. 44, 231–243.

Pfaffl, M.W. (2001) A new mathematical model for relative quanti-

fication in real-time RT-PCR. Nucleic Acids Res. 29, e45.

Plotnikova, J.M., Reuber, T.L., Ausubel, F.M. and Pfister, D.H. (1998)

Powdery mildew pathogenesis of Arabidopsis thaliana. Mycolo-
gia, 90, 1009–1016.

Reuber, T.L., Plotnikova, J.M., Dewdney, J., Rogers, E.E., Wood,

W. and Ausubel, F.M. (1998) Correlation of defence gene
induction defects with powdery mildew susceptibility in Ara-
bidopsis enhanced disease susceptibility mutants. Plant J. 16,
473–485.

Rogers, E.E. and Ausubel, F.M. (1997) Arabidopsis enhanced dis-

ease susceptibility mutants exhibit enhances susceptibility to
several bacterial pathogens and alterations in PR-1 gene expres-
sion. Plant Cell, 9, 305–316.

Scheideler, M., Schlaich, N.L., Fellenberg, K., Beissbarth, T., Hauser,

N.C., Vingron, M., Slusarenko, A.J. and Hoheisel, J.D. (2002)
Monitoring the switch from housekeeping to pathogen defense
metabolism in Arabidopsis thaliana using cDNA arrays. J. Biol.
Chem. 277, 10555–10561.

Semizarov, D., Frost, L., Sarthy, A., Kroeger, P., Halbert, D.N. and

Fesik, S.W. (2003) Specificity of short interfering RNA determined
through gene expression signatures. Proc. Natl Acad. Sci. USA,
100, 6347–6352.

Soylu, S., Brown, I. and Mansfield, J.W. (2005) Cellular reactions in

Arabidopsis following challenge by strains of Pseudomonas
syringae: from basal resistance to compatibility. Physiol. Mol.
Plant Pathol. 66, 232–243.

Stone, J.M., Heard, J.E., Asai, T. and Ausubel, F.M. (2000) Simula-

tion of fungal-mediated cell death by fumonisin B1 and selection
of fumonisin B1-resistant (fbr) Arabidopsis mutants. Plant Cell,
12, 1811–1822.

Tao, Y., Xie, Z., Chen, W., Glazebrook, J., Chang, H.-S., Han, B., Zhu,

T., Zou, G. and Katagiri, F. (2003) Quantitative nature of Arabid-
opsis responses during compatible and incompatible interactions
with the bacterial pathogen Pseudomonas syringae. Plant Cell,
15, 317–330.

Thordal-Christensen, H., Zhang, Z., Wei, Y. and Collinge, D.B. (1997)

Subcellular localization of H

2

O

2

in plants. H

2

O

2

accumulation in

papillae and hypersensitive response during the barley–powdery
mildew interaction. Plant J. 11, 1187–1194.

Tognolli, M., Penel, C., Greppin, H. and Simon, P. (2002) Analysis

and expression of the class III peroxidase large gene family in
Arabidopsis thaliana. Gene, 288, 129–138.

Torres, M. A. and Dangl, J.L. (2005) Functions of the respiratory

burst oxidase in biotic interactions, abiotic stress and develop-
ment. Curr. Opin. Plant Biol. 8, 397–403.

Torres, M.A., Onouchi, H., Hamada, S., Machida, C., Hammond-

Kosak, K.E. and Jones, J.D.G. (1998) Six Arabidopsis thaliana
homologues of the human respiratory burst oxidase (gp91

phox

).

Plant J. 14, 365–370.

Torres, M.A., Dangl, J.L. and Jones, J.D.G. (2002) Arabidopsis

gp91

phox

homologues, AtrbohD and AtrbohF are required for

accumulation of reactive oxygen intermediates in the plant def-
ense response. Proc. Natl Acad. Sci. USA, 99, 517–522.

862 Laurence V. Bindschedler et al.

ª 2006 The Authors

Journal compilation

ª 2006 Blackwell Publishing Ltd, The Plant Journal, (2006), 47, 851–863

Torres, M.A., Jones, J.D.G. and Dangl, J.L. (2005) Pathogen-induced

NADPH oxidase-derived reactive oxygen intermediates suppress
spread of cell death in Arabidopsis thaliana. Nat. Genet. 37, 1130–
1134.

Vale´rio, L., de Meyer, M., Penel, C. and Dunand, C. (2004) Expression

analysis of the Arabidopsis peroxidase multigenic family. Phyt-
ochemistry, 65, 1331–1342.

Waring, J.F., Jolly, R.A., Ciurlionis, R., Lum, P.Y., Praestgaard, J.T.,

Morfitt, D.C., Buratto, B., Roberts, C., Schadt, E. and Ulrich, R.G.
(2001) Clustering of hepatotoxins based on mechanism of toxicity
using gene expression profiles. Toxicol. Appl. Pharmacol. 175,
28–42.

Welinder, K.G., Justesen, A.F., Kjaersgard, I.V., Jensen, R.B., Ras-

mussen, S.K., Jespersen, H.M. and Duroux, L. (2002) Structural
diversity and transcription of class III peroxidases from Arabid-
opsis thaliana. Eur. J. Biochem. 269, 6063–6081.

Whalen, M.C., Innes, R.W., Bent, A.F. and Staskawicz, B.J. (1991)

Identification of Pseudomonas syringae pathogens of Arabidop-
sis and a bacterial locus determining avirulence on both Arabid-
opsis and soybean. Plant Cell, 3, 49–59.

Wojtaszek, P. (1997) The oxidative burst: a plant’s early response

against infection. Biochem. J. 322, 4158–4163.

Peroxidase-dependent apoplastic oxidative burst 863

ª 2006 The Authors
Journal compilation

ª 2006 Blackwell Publishing Ltd, The Plant Journal, (2006), 47, 851–863