Characterization of a Pleurotus ostreatus fruiting body-specific hydrophobin gene, Po.hyd

Journal of Basic Microbiology 2007, 47, 317 – 324

317

www.jbm-journal.com

Research Paper

Characterization of a Pleurotus ostreatus fruiting
body-specific hydrophobin gene, Po.hyd

Aimin Ma

, Linjun Shan

, Nianjiu Wang

, Liesheng Zheng

, Liguo Chen

and Bijun Xie

College of Food Science and Technology, Huazhong Agricultural University, Wuhan, Hubei, P.R. China

College of Plant Science and Technology, Huazhong Agricultural University, Wuhan, Hubei, P.R. China

Hydrophobins are a family of small, moderately hydrophobic proteins with eight cysteine
residues arranged in a conserved pattern. A full-length cDNA, designated Po.hyd, corresponding
to a hydrophobin gene of Pleurotus ostreatus was obtained in our previous work. The Po.hyd gene
contains a 333 bp open reading frame (ORF), which is interrupted by two typical classI introns.
There was no consensus signal for a polyA tail detected in the 3

′untranslated region. However,

an analogous T- or TG-rich motif was observed that probably influence the formation of the
mRNA 3

′ end. We assign the putative Po.HYD protein to the classI hydrophobins since its

sequence arrangement and hydropathy pattern has a high consensus to other known class I
hydrophobins. Northern analysis showed that the Po.hyd gene was abundantly expressed
throughout the fruiting process (from primordium to mature fruiting body) but silenced
during vegetative growth of the mycelium. Southern blot analysis showed Po.hyd to be a single
copy gene in the genome of dikaryotic strain likely to locate at the same locus within the two
parental genomes.

Keywords: Pleurotus ostreatus / Hydrophobin / Fruiting body development

Received: January 02, 2007; returned for modification: January 12, 2007; accepted January 30, 2007

DOI 10.1002/jobm.200710317

Introduction

Pleurotus ostreatus, the oyster mushroom, is one of the
most widely cultivated edible fungi. In addition to a
tasty food resource, it has useful environmental appli-
cations, such as bioconversion of agricultural wastes
(Cohen et al. 2002), biodegradation of lignin (Ha et al.
2001) and biosorption of toxic heavy metals (Pan et al.
2005), attracting a great deal of interest from biochem-
ists, ecologists and molecular biologists.
In mushrooms, fruiting is the most fascinating and
complicated process of the life cycle. There are several
recent studies of P. ostreatus developmental genes (Lee
et al. 2002, Sunagawa and Magae 2005), however, the
molecular mechanisms governing fruiting events in

Correspondence: Dr. Aimin Ma, College of Food Science and Technol-
ogy, Huazhong Agricultural University, Wuhan, Hubei 430070, P.R.
China
E-mail: maaimin@yahoo.com
Tel.: +86-27-87282927
Fax: +86-27-87396057

P. ostreatus are still poorly understood. The situation of
insufficient information about the fruiting process
probably contributed to the fact that only few specifi-
cally expressed genes or their products were intensively
studied.
Hydrophobins are a family of small and moderately
hydrophobic proteins secreted by filamentous fungi,
which contain eight cysteine residues with a conserved
spacing pattern (Wessels 1996). Hydrophobins take part
in a broad spectrum of biological functions during fun-
gal morphogenesis, pathogenesis and symbiosis, and
their expression is under the control of complex factors
(Whiteford and Spanu 2002).
In our previous work, a full-length cDNA encoding a
fruiting-body-specific hydrophobin of P. ostreatus, desig-
nated Po.hyd, was isolated through a differential screen-
ing method (Ma and Kwan 2001). Here, we analyze the
nucleotide sequence and deduced amino acid sequence
of Po.hyd, determine its expression pattern by Northern
and estimate gene copy number by Southern blot
analyses.

318 A.

et al.

Journal of Basic Microbiology 2007, 47, 317 – 324

www.jbm-journal.com

Materials and methods

Strains and culture conditions
The Pleurotus ostreatus dikaryotic strain Pd739, and its
two parental monokaryotic strains Pm007 and Pm039
were provided by the Mushroom Spawn Center, Huaz-
hong Agricultural University. Vegetative mycelia and
fruiting bodies were produced as previously described
(Ma and Kwan 2001). Samples from four different de-
velopmental stages including mycelia, primordia (2 –
3 mm in diameter), young fruiting bodies (no gill
formed) and mature fruiting bodies (gills formed and
spores dispersed) were harvested and stored at –80

°C.

PCR amplification and DNA sequencing
Genomic DNA was isolated from dikaryotic strain
Pd739 and used as template for PCR amplification
(Zhang et al. 1998). Gene specific primers for Po.hyd
were designed as follows: hyd1: 5

′gggagttcgaggacaga-

caa3

′; hyd2: 5′atcaacaccatcggcaagtt3′. After preheating

at 94 °C (10 min), PCR reaction was conducted with 35
cycles at 94

°C (1 min); 55 °C (1 min) and 72 °C (1 min),

followed by one 10 min cycle at 72

°C. The amplified

product was cloned using the PCR-Script SK (+) cloning
kit according to the manufacturer’s protocol (Strata-
gene). The plasmid DNA was prepared from the trans-
formants using the Wizard Plus Minipreps DNA Puri-
fication System (Promega). The partial nucleotide se-
quence of the amplicon was determined with the ABI

PRISM Dye Terminator Cycle Sequencing Ready Reac-
tion Kit (Perkin-Elmer) and a Perkin-Elmer Applied
Biosystem Genetic Analyzer 3100 (PE ABI.).

RNA isolation and Northern blot
Total RNA was extracted from mycelia, primordia,
young fruit bodies and mature fruit bodies produced
from the dikaryotic strain Pd739 using the TRI® Reagent
(Molecular Research Center) according to the manufac-
turer’s protocol. About 20

µg of each sample was sepa-

rated on a 1.0% denaturing agarose-formaldehyde gel,
transferred onto a Hybond-N

nylon filter (Amersham

Biosciences) and then fixed by UV cross-linking (Strata-
gene) (Leung et al. 2000). The cDNA probe corresponding
to Po.hyd was prepared using the random priming pro-
cedure (Megaprime DNA labeling System, Amersham
Biosciences). The blotted filter was hybridized with de-
natured probe in 5

× SSPE, 5 × denhardt solution, 0.5%

SDS and 50% formamide and 20

µg denatured salmon

sperm DNA at 42

°C. Finally, the filter was exposed to an

X-ray film at –80

°C for 48 h (Ng et al. 2000).

DNA isolation and Southern blot
Genomic DNA was prepared from mycelia of the di-
karyotic strain Pd739 and its parental monokaryotic
strains Pm007 and Pm039 that were grown on pota-
to dextrose agar medium (Difco). The DNAs were com-
pletely digested by EcoRV or XhoI (Promega) and sepa-

Figure 1. Nucleotide sequence and deduced amino acid sequence of the Po.hyd gene (GenBank accession no. AF331452). The coding
nucleotides are in upper case letters; non-coding nucleotides and introns are in lower case letters. Consensus splice sites are underlined
and the potential internal sequences for lariat formation within introns are double-underlined. An analogous T- or TG-rich motif that probably
indicates a potential signal for adding a polyA tail is boxed. Nucleotide sequence is numbered on the left-hand and starts from the
translational start codon (+1); deduced amino acid sequence is numbered on the right-hand. The putative N-glycosylation sites and
O-glycosylation sites were marked with closed triangles and open triangles, respectively.

Journal of Basic Microbiology 2007, 47, 309 – 316

Pleurotus ostreatus fruiting body-specific hydrophobin gene

319

www.jbm-journal.com

rated on a 1.0% agarose gel. The resulting products
were transferred onto a Hybond-N

nylon filter (Amer-

sham Biosciences). The hybridization procedure was
similar to that of the Northern blot.

Results

Nucleotide sequence analysis of the Po.hyd gene
The full-length cDNA sequence of the Po.hyd gene con-
tains a 73bp 5

′non-coding region, a 333bp ORF and a

212bp 3

′non-coding sequence before the start point of

the polyadenylation tail (Fig. 1). Gene specific primers
for Po.hyd were designed based on the cDNA sequence,

the DNA sequence containing the ORF was obtained by
PCR amplification. The location of two small introns
(each 59bp in size) was determined by alignment of the
genomic DNA and cDNA sequences. These two introns
are both typical class-II introns, which have the con-
sensus splice site common to most filamentous fungi:
5

′ GT and 3′ YAG, Y = C or T (Gurr et al. 1987). More-

over, the internal sequence required for lariat forma-
tion (NNCTPuAPy, N = A, C, G or T; Pu = A or G; Py = C
or T) (Unkles 1992) was also found within each intron
sequence. In the 3

′non-coding region, there was no

consensus AATAAA polyadenylation signal prior to the
start point of the polyA tail. However, similar to the
case of the Aa-pri2 hydrophobin gene, an analogous

Figure 2. (a) Comparison of the deduced amino acid sequence of Po.HYD hydrophobin with those of known fruiting-body-specific
hydrophobins from Pleurotus ostreatus. Amino acid sequences of POH1 (GenBank accession no. CAA12391) and FBH1 (GenBank
accession no. CAC95144) were retrieved from GenBank database. The conservation degree of each residue was indicated by a line plot,
and the eight conserved cysteine residues were highlighted with asterisks.
(b) Comparative analysis of hydropathy pattern among Po.HYD, POH1 and FBH1 hydrophobins. Hydrophobicity was calculated according
to the Kyte and Doolittle algorithm using a window size of six amino acid residues (Kyte and Doolittle 1982). Hydrophobic regions are given
by a positive index, whereas hydrophilic regions are given by a negative index. A vertical arrow indicates the putative cleavage site of signal
peptide for each protein.

320 A.

et al.

Journal of Basic Microbiology 2007, 47, 317 – 324

www.jbm-journal.com

T- or TG-rich motif surrounding the mRNA cleavage site
(Santos and Labarere 1999) that probably indicates a
potential signal for adding a polyA tail was observed.

Comparative analysis of the deduced amino acid
sequence
Sequence analysis indicated that the Po.hyd gene en-
codes a putative 110-amino-acid hydrophobin protein
with a calculated molecular mass of 11406 Da and an
isoelectric point of 7.26. The first 27 amino acid resi-
dues were predicted to correspond with a signal peptide
for secretion (SignalP 3.0 Server). If this signal peptide
is cleaved off, the mature protein would become 83aa
in length, with a molecular mass of 8359 Da. The
isoelectric point of the mature protein would reduce to
4.81, based on three negatively charged residues and
only one positively charged side chain. There are two
potential N-glycosylation sites located at Asn93 and
Asn107, corresponding to Asn-Xaa-Ser/Thr consensus
motifs and three putative O-glycosylation sites at
Thr32, Thr37 and Thr45 (predicted by NetNGlyc 1.0 and
NetOGlyc 3.1 Server, respectively; Fig. 1).
The two fruiting-body-specific hydrophobins of Pleuro-
tus ostreatus, POH1 (Asgeirsdottir et al. 1998) and FBH1
(Penas et al. 1998), isolated from different strains were
compared to this novel one (Fig. 2a). It is clear that the
identity between Po.HYD and POH1 (40 identical resi-
dues) or FBH1 (42 identical residues) is limited. How-
ever, the line plot visualizing amino acid conservation
showed two highly conserved domains around two cys-
teine clusters: the first three cysteine residues located in
the N-terminal region (aa 28 ~ aa 50) and the last five
cysteine residues located in the C-terminal region (last
40 aa). Furthermore, the hydropathy patterns of the
three hydrophobins were remarkably similar (Fig. 2b):
each of them contains a hydrophobic N-terminus pre-
dicted to be a signal peptide for secretion, followed by a
main hydrophilic region, a hydrophobic core, two small
hydrophilic areas and a hydrophobic carboxy-terminal
end. Nevertheless, the proportion of hydrophilic regions
in Po.HYD was slightly larger than that in both POH1
and FBH1. That is due to a higher proportion of hydro-
philic residues in Po.HYD, which lead to a relative lower
average hydrophobicity of this protein.

Expression pattern of the Po.hyd gene
Northern analysis was carried out to study the expres-
sion pattern of Po.hyd. Total RNAs of the dikaryotic
strain Pd739 were isolated from four developmental
stages: vegetative mycelium, primordium, young fruit-
ing body and mature fruiting body. The Northern blot
shows strong hybridization signals from the primor-

Figure 3. Northern blot analysis showing expression pattern of the
Po.hyd gene. Total RNAs were isolated from four developmental
stages: vegetative mycelia (lane1), primordia (lane2), young fruiting
bodies (lane3) and mature fruiting bodies (lane4). Northern
hybridization (upper panel) was performed using the cloned Po.hyd
cDNA as a probe, and equal loading of RNA samples were con-
firmed by intensity of ethidium bromide fluorescence (lower panel).

dium stage to the mature fruiting body, while no signal
was detected in vegetative mycelium (Fig. 3). A steady-
level of RNA accumulation during the entire fruiting
process suggested that a high expression of Po.hyd is
important to fruiting body initiation and maturation.

Southern analysis of the Po.hyd gene
Southern blot analysis determined the gene copy num-
ber of Po.hyd in the dikaryotic strain Pd739 and its pa-
rental monokaryons, Pm007 and Pm039. Under strin-
gent conditions, a single band with identical sizes
(3.0 kbp for XhoI; 3.5 kbp for EcoRV) was observed in
each lane (Fig. 4). This result suggests that Po.hyd is
a single copy gene presented in both the genome of the

Figure 4. Southern blot analysis of the Po.hyd gene. Genomic
DNAs were prepared from dikaryotic strain Pd739 (lanes 1, 2),
monokaryotic strains Pm007 (lanes 3, 4) and Pm039 of P. ostreatus
(lanes 5, 6). Equal loadings (about 5

µg) of these DNAs were

separately digested by XhoI (lanes 1, 3 and 5) or EcoRV (lanes 2, 4
and 6). A part of Po.hyd gene was used as a probe.

Journal of Basic Microbiology 2007, 47, 317–324

Pleurotus ostreatus fruiting body-specific hydrophobin gene

321

www.jbm-journal.com

dikaryotic strain Pd739 and its two parental monokary-
ons. The identical size of the fragments indicates that it
is located at the same locus in each of the two parental
genomes.

Discussion

Hydrophobins are able to self-assemble into an amphi-
pathic membrane when encountering hydrophilic-
hydrophobic interfaces, such as air-water, water-oil and
cell wall-air. They are divided into two distinct groups
based on their solubility, hydropathy pattern and ar-
rangement of cysteine residues (Wessels 1997). The
hydropathy pattern of Po.HYD is remarkably similar to
those known classI hydrophobins isolated from Pleuro-
tus ostreatus (Fig. 2b). Its deduced amino acid sequence is
consistent with the arrangement of the eight conserved
cysteine residues for classI hydrophobins: C-X

5–7

-C-C-

19–39

-C-X

8–23

-C-X

-C-C-X

6–18

-C-X

2–13

, while the length of

the intervening sequences between cys3 and cys4 in
classI hydrophobins is much shorter (Kershaw and
Talbot 1998, Wosten 2001). This is in the agreement
with the observation that hydrophobins isolated from
basidiomycetes so far all belong to classI hydrophobins
(Wosten 2001). Therefore, we could conclude that the
putative Po.HYD protein is a classI hydrophobin.
  The immature Po.HYD protein has an isoelectric
point at 7.26. When the first 27 amino acids, predicted
as a signal peptide, are removed, the pI for the mature
protein reduces to 4.81. The lower pI for the mature
Po.HYD is coincidence with the external pH of hyphal
membrane and that probably would facilitate self-
assembly of hydrophobin monomers.
  Glycosylation is a type of post-translational modifica-
tion observed for SC3 secreted by Schizophyllum commune
(de Vocht et al. 1998) and POH2 produced by P. ostreatus
(Asgeirsdottir  et al. 1998). The glycosylated hydropho-
bins contain a long and serine- or threonine-rich N-
terminal sequence preceding the first cysteine residue
in the mature protein. Within this region, sugar resi-
dues, for example mannose, could modify the serine or
threonine residues and affect the surface properties of
the hydrophilic side of the assembled hydrophobin
membrane. There were some predicted glycosylation
sites found interspersed in the amino acid sequence of
Po.HYD (Fig. 1). However, like most unglycosylated
hydrophobins, the mature Po.HYD protein has a short
N-terminal sequence preceding the first cysteine resi-
due (seven amino acids) and there was no glycosylation
site within this region. Whether the Po.HYD is glycosy-
lated requires further study at the protein level.

The ORF encoded by Po.hyd is interrupted by two
small introns, which were identified through align-
ment of DNA and cDNA sequences. These two introns
are both typical classI

introns based on the consensus

splice site and internal sequence for lariate formation
(Gurr et al. 1987). Intron splicing may influence genetic
expression levels. Lugones et al. (1999) showed that the
presence of an intron is essential for the homologous
and heterologous expression of hydrophobin genes in
S. commune. Furthermore, they demonstrated that the
effect of an intron on mRNA accumulation is not de-
pending on the presence of a particular sequence next
to the consensus splicing sequences within the intron.
Similar to the Aa-pri2 hydrophobin gene (Santos and
Labarere 1999), there was no evidence for a polyade-
nylation signal but an analogous T- or TG-rich motif
could be detected in the 3

′untranslated region of Po.hyd

before the onset of the polyA tail (Fig. 1). Schuren
(1992) had analyzed 17 genes from basidiomycetes and
found no conserved sequence for the addition of a
polyA tail in their 3’non-coding sequences. Thereby, the
mRNA 3

′ end formation of Po.hyd may be influenced by

the analogous T- or TG-rich motif or other unknown
mechanisms.
In many homobasidiomycetes, there are multiple
hydrophobin genes in a single species, and their

expression is mostly developmentally regulated. In

S. commune, SC3 is expressed in both monokaryotic and
dikaryotic mycelia, while SC1,  SC4 and SC6 are only
expressed in dikaryotic mycelia (Mulder and Wessels
1986); CoH1 and CoH2 from Coprinus cinereus are specifi-
cally expressed in monokaryotic mycelia  (Asgeirsdottir
et al. 1997); ABH1 from Agaricus bisporus is highly ex-
pressed at the time of basidiocarp expansion (Lugones
et al. 1996, de Groot et al. 1996) and ABH3 is expressed
just during vegetative growth (Lugones et al. 1998).
Except for Po.hyd, seven hydrophobin genes have been
identified from two strains of Pleurotus ostreatus.  Poh1
and fbh1 are specifically expressed during fruiting body
formation;  poh2,  poh3,  vmh1 and vmh2 are expressed
only at the vegetative stage; vmh3 is expressed through-
out the life cycle. Moreover, poh3  and  vmh2 are proved
to be alleles of the same gene. Northern analysis of
Po.hyd indicated that it is a fruiting-body-specific gene,
which is abundantly expressed during the entire fruit-
ing body formation process but is silenced during the
vegetative stage. Southern analysis indicated that Po.hyd
is a single copy gene with limited homology to the
other known hydrophobin sequences from P. ostreatus.
  To evaluate the structural and functional relation-
ships between Po.HYD and other hydrophobins found
in basidiomycetes, a phylogenetic tree was constructed

322 A.

et al.

Journal of Basic Microbiology 2007, 47, 317 – 324

www.jbm-journal.com

based on amino acid homology. Po.HYD is most phy-
logenetically similar to SC1, SC4 and SC6 hydrophobins,
which were proved to be involved in fruiting body for-
mation in S. commune. However, two fruiting body spe-
cific hydrophobins POH1 and FBH1 from P. ostreatus are
similar to each other and relatively distant from
Po.HYD (Fig. 5). In situ mRNA hybridization of fbh1

revealed it is synthesized throughout fruiting body
with the exception of gills (Penas et al. 1998), while
immunology studies showed the SC4 is produced in the
inner tissues of the fruiting body. The close phyloge-
netic relationship suggests that Po.HYD might play
some similar roles as SC4 during fruiting body forma-
tion. Experimental evidence showed that SC4 is self-

Figure 5. Dendrogram of class I hydrophobins from basidiomycetes obtained by the neighbour-joining algorithm based on amino acid
sequences (Saitou and Nei 1987). The N-terminal region preceding the first cysteine residue of each sequence was removed, since they
comprise the signal sequences in variable length and would be specific for different hydrophobins (Wosten 2001). Hydrophobins that are
principally or specifically expressed during fruiting body development are emphasized by a closed dot. The scale bar represents 0.1 amino
acid substitutions per position. GenBank accession numbers are shown as follows: Aa-Pri2/AAD41222 from Agrocybe aegerita (Santos and
Labarere 1999); HYPA or ABH1/CAA61530 and HYPC or ABH2/CAA62332 from Agaricus bisporus (de Groot et al. 1996, Lugones et al.
1996); ABH3/CAA74940 from A. bisporus (Lugones et al. 1998); CoH1/CAA71652 and CoH2/CAA71653 from Coprinus cinereus
(Asgeirsdottir et al. 1997); DGH1/CAC86002, DGH2/CAC86005 and DGH3/CAC86006 from Dictyonema glabratum (Trembley et al. 2002);
FVH1/BAB17622 from Flammulina velutipes (Ando et al. 2001); Fv-HYD1/BAD08615 from F. velutipes (Yamada et al. 2005);
HYD1/AAL05426 from Tricholoma terreum (Mankel et al. 2002); HYDPt-1/AAC49307, HYDPt-2/AAC49308 and HYDPt-3/AAC49306 from
Pisolithus tinctorius (Tagu et al. 1996); Le.HYD1/AAF61065 and Le.HYD2/AAF61066 from Lentinula edodes (Ng et al. 2000);
POH1/CAA12391, POH2/CAA12392 and POH3/CAA76494 from Pleurotus ostreatus (Asgeirsdottir et al. 1998); FBH1/CAC95144 from
P. ostreatus (Penas et al. 1998); VMH1/CAD12829, VMH2/CAD12833 and VMH3/CAD12831 from P. ostreatus (Penas et al. 2002);
PNH1/BAB84545, PNH2/BAB84546 and PNH3/BAB84547 from Pholiota nameko (Tasaki et al. 2004); SC1/CAA25366 and SC4/AAA33927
from Schizophyllum commune (Schuren and Wessels 1990); SC3/AAA96324 from S. commune (de Vocht et al. 1998); from
SC6/CAA07545 from S. commune (Wessels et al. 1995).

Journal of Basic Microbiology 2007, 47, 317–324

Pleurotus ostreatus fruiting body-specific hydrophobin gene

323

www.jbm-journal.com

assembled at the interface between the mucilage and
the gas phase. The assembled SC4 hydrophobin mem-
brane provides air channels with a hydrophobic rodlet
layer that prevents fruiting bodies from filling with
water during cycles of drying and wetting (Wessels
1994, 1996, van Wetter 2000). Determining the exact
function of Po.HYD will require further investigation,
such as protein purification, immunological localiza-
tion and RNA interference.

Acknowledgements

This work was partially supported by grants from the
National Natural Science Foundation of China (NSFC)
(No.30170658 and No.39770530) to Aimin Ma. We
thank Dr. Tanya Dahms for her critical review.

References

Ando, A., Harada, A., Miura, K. and Tamai, Y., 2001. A gene

encoding a hydrophobin, fvh1, is specifically expressed after
the induction of fruiting in the edible mushroom Flammuli-
na velutipes. Curr. Genet.,

39, 190–197.

Asgeirsdottir, S.A., de Vries, O.M.H. and Wessels, J.G.H., 1998.

Identification of three differentially expressed hydropho-
bins in Pleurotus ostreatus (oyster mushroom). Microbiology,

144, 2961–2969.

Asgeirsdottir, S.A., Halsall, J.R. and Casselton, L.A., 1997.

Expression of two closely linked hydrophobin genes of Co-
prinus cinereus is monokaryon-specific and down-regulated
by the oid-1 mutation. Fungal Genet. Biol.,

22, 54–63.

Cohen, R., Persky, L. and

Hadar, Y., 2002. Biotechnological

applications and potential of wood-degrading mushrooms
of the genus Pleurotus. Appl. Microbiol. Biotechnol.,

58,

582 – 594.

De Groot, P.W.J., Schaap, P.J., Sonnenberg, A.S.M., Visser, J.

and van Griensven, L.J., 1996. The Agaricus bisporus hypA ge-
ne encodes a hydrophobin and specifically accumulates in
peel tissue of mushroom caps during fruit body develop-
ment. J. Mol. Biol.,

257, 1008–1018.

De Vocht, M.L., Scholtmeijer, K., van der Vegte, E.W., de Vries,

O.M.H., Sonveaux, N., Wosten, H.A.B., Ruysschaert, J.M.,
Hadziioannou, G., Wessels, J.G.H. and Robillard, G.T., 1998.
Structural characterization of the hydrophobin SC3, as a
monomer and after self-assembly at hydrophobic/hydro-
philic interfaces. Biophys. J.,

74, 2059–2068.

Gurr, S.J., Unkles, S.E. and Kinghorn, J.R., 1987. The structure

and organization of nuclear genes in filamentous fungi. In:
Gene Structure in Eukaryotic Microbes (SGM Special Publi-
cations; J.R. Kinghorn, ed.), pp. 93 – 139. IRL Press Oxford.

Ha, H.C., Honda, Y., Watanabe, T. and Kuwahara, M., 2001.

Production of manganese peroxidase by pellet culture of
the lignin-degrading basidiomycete, Pleurotus ostreatus. Appl.
Microbiol. Biotechnol.

55, 704–711.

Kershaw, M.J. and Talbot, N.J., 1998. Hydrophobins and repel-

lents: Proteins with fundamental roles in fungal morpho-
genesis. Fungal Genet. Biol.,

23, 18–33.

Kyte, J. and Doolittle, R.F., 1982. A simple method for display-

ing the hydropathic character of a protein. J. Mol. Biol.,

157, 105–132.

Lee, S.H., Kim, B.G., Kim, K.J., Lee, J.S., Yun, D.W., Hahn, J.H.,

Kim, G.H., Lee, K.H., Suh, D.S., Kwon, S.T., Lee, C.S. and
Yoo, Y.B., 2002. Comparative analysis of sequences expres-
sed during the liquid-cultured mycelia and fruit body sta-
ges of Pleurotus ostreatus. Fungal Genet. Biol.,

35, 115–134.

Leung, G.S.W., Zhang, M., Xie, W.J. and Kwan, H.S., 2000.

Identification by RNA fingerprinting of genes differentially
expressed during the development of the basidiomycete
Lentinula edodes. Mol. Gen. Genet.,

262, 977-990.

Lugones, L.G., Bosscher, J.S., Scholtmeijer, K., de Vries, O.M.H.

and Wessels, J.G.H., 1996. An abundant hydrophobin
(ABH1) forms hydrophobic rodlet layers in Agaricus bisporus
fruiting bodies. Microbiology,

142, 1321–1329.

Lugones, L.G., Scholtmeijer, K., Klootwijk, R. and Wessels,

J.G.H., 1999. Introns are necessary for mRNA accumulation
in Schizophyllum commune. Mol. Microbiol.,

32, 681–689.

Lugones, L.G., Wosten, H.A.B. and Wessels, J.G.H., 1998. A

hydrophobin (ABH3) specifically secreted by vegetatively
growing hyphae of Agaricus bisporus (common white button
mushroom). Microbiology,

144, 2345–2353.

Ma, A.M. and Kwan, H.S., 2001. Cloning of differentiation and

development related gene fragments in Pleurotus ostreatus.
J. Huazhong Agr. Univ.,

20, 299–302.

Mankel, A., Krause, K. and Kothe, E., 2002. Identification of a

hydrophobin gene that is developmentally regulated in the
ectomycorrhizal fungus Tricholoma terreum. Appl. Environ.
Microbiol.,

68,1408–1413.

Mulder, G.H. and Wessels, J.G.H., 1986. Molecular cloning of

RNAs differentially expressed in monokaryons and dikary-
ons of Schizophyllum commune. Exp. Mycol.,

10, 214–227.

Ng, W.L., Ng, T.P. and Kwan, H.S., 2000. Cloning and characte-

rization of two hydrophobin genes differentially expressed
during fruit body development in Lentinula edodes. FEMS
Microbiol, Lett.,

185, 139–145.

Pan, X.L., Wang, J.L. and Zhang, D.Y., 2005. Biosorption of Pb

(II) by Pleurotus ostreatus immobilized in calcium alginate
gel. Process Biochem.,

40, 2799–2803.

Penas, M.M., Asgeirsdottir, S.A., Lasa, I., Culianez-Macia, F.A.,

Pisabarro, A.G., Wessels, J.G.H. and Ramirez, L., 1998. Iden-
tification, characterization, and in situ detection of a frui-
ting-body-specific hydrophobin of Pleurotus ostreatus. Appl.
Environ. Microbiol.,

64, 4028–4034.

Penas, M.M., Rust, B., Larraya, L.M., Ramirez, L. and Pisabarro,

A.G., 2002. Differentially regulated, vegetative-mycelium-
specific hydrophobins of the edible basidiomycete Pleurotus
ostreatus. Appl. Environ. Microbiol.,

68, 3891–3898.

Saitou, N. and Nei, M., 1987. The neighbor-joining method:

a new method for reconstructing phylogenetic trees. Mol.
Biol. Evol.,

4, 406–425.

Santos, C. and Labarere, J., 1999. Aa-Pri2, a single-copy gene

from Agrocybe aegerita, specifically expressed during fruiting
initiation, encodes a hydrophobin with a leucine-zipper
domain. Curr. Genet.,

35, 564–570.

324 A.

et al.

Journal of Basic Microbiology 2007, 47, 317 – 324

www.jbm-journal.com

Schuren, F.H.J., 1992. Regulation of gene expression during

fruit-body development in Schizophyllum commune. PhD The-
sis, University of Groningen.

Schuren, F.H.J. and Wessels, J.G.H., 1990. Two genes specifi-

cally expressed in fruiting dikaryons of Schizophyllum com-
mune: homologies with a gene not regulated by mating-type
genes. Gene.

90, 199–205.

Sunagawa, M. and Magae, Y., 2005. Isolation of genes differen-

tially expressed during the fruit body development of Pleu-
rotus ostreatus by differential display of RAPD. FEMS Micro-
biol. Lett.,

246, 279–284.

Tagu, D., Nasse, B. and Martin, F., 1996. Cloning and characte-

rization of hydrophobins-encoding cDNAs from the ecto-
mycorrhizal basdiomycete Pisolithus tinctorius. Gene,

168,

93 – 97.

Tasaki, Y., Ohata, K., Hara, T. and Joh, T., 2004. Three genes

specifically expressed during phosphate deficiency in Pholio-
ta nameko strain N2 encode hydrophobins. Curr. Genet.,

45,

19 – 27.

Trembley, M.L., Ringli, C. and Honegger, R., 2002. Hydropho-

bins DGH1, DGH2, and DGH3 in the lichen-forming basidi-
omycete Dictyonema glabratum. Fungal Genet. Biol.,

35, 247–

259.

Unkles, S.E., 1992. Gene organization in industrial filamen-

tous fungi. In: Applied Molecular Genetics of Filamentous
Fungi (J.R. Kinghorn and G. Turner, eds.), pp. 28 – 53. Chap-
man and Hall London.

Van Wetter, M.A., Wosten, H.A.B. and Wessels, J.G.H., 2000.

SC3 and SC4 hydrophobins have distinct roles in formation
of aerial structures in dikaryons of Schizophyllum commune.
Mol. Microbiol.,

36, 201–210.

Wessels, J.G.H., 1994. Developmental regulation of fungal cell

wall formation. Annu. Rev. Phytopathol.,

32, 413–437.

Wessels, J.G.H., 1996. Fungal hydrophobins: proteins that

function at an interface. Trends Plant Sci.,

1, 9–15.

Wessels, J.G.H., 1997. Hydrophobins: proteins that change the

nature of the fungal surface. Adv. Microb. Physiol.,

38,

1 – 45.

Wessels, J.G.H., Asgeirsdottir, S.A., Birkenkamp, K.U., de

Vries, O.M.H., Lugones, L.G., Scheer, J.M.J., Schuren, F.H.J.,
Schuurs, T.A., van Wetter, M.A. and Wosten, H.A.B., 1995.
Genetic regulation of emergent growth in Schizophyllum
commune. Can. J. Bot.,

73, S273–S281.

Whiteford, J.R. and Spanu, P.D., 2002. Hydrophobins and the

interactions between fungi and plants. Mol. Plant. Pathol.,

3, 391–400.

Wosten, H.A.B., 2001. Hydrophobins: Multipurpose proteins.

Annu. Rev. Microbiol.,

55, 625–646.

Yamada, M., Sakuraba, S., Shibata, K., Inatomi, S., Okazaki, M.

and Shimosaka, M., 2005. Cloning and characterization of a
gene coding for a hydrophobin, Fv-hyd1, specifically expres-
sed during fruiting body development in the basidiomycete
Flammulina velutipes. Appl. Microbiol. Biotechnol.,

67, 240–

246.

Zhang, M., Xie, W.J., Leung, G.S.W., Deane, E.E. and Kwan,

H.S., 1998. Cloning and characterization of the gene enco-
ding beta subunit of mitochondrial processing peptidase
from the basidiomycetes Lentinula edodes. Gene,

206, 23–27.